The Use of the Digital Off-Air Radio Events Archive System EventsBNR in the Bulgarian National Radio

The paper describes the use of the system created for Digital off-air radio events archive EventsBNR in the Bulgarian National Radio. The system provides efficient application of modern information technologies in radio archiving.

Cultural Institutions and Citizen Science: Some Educational Aspects

Report published in the Proceedings of the National Conference on "Education and Research in the Information Society", Plovdiv, May, 2015

The cultural politics of Jamaican dancehall music in South Florida

For Jamaicans throughout the Diaspora, dancehall music has emerged as their most potent cultural symbol demarcating their place of origin and continued sense of national belonging. Due to its unapologetic nature and tendency to tackle divisive issues such as those involving race, class, and sex, dancehall has been unfairly branded as wholly misogynistic and violent. This dissertation attempts to counter some of these assertions by exploring the cultural politics of dancehall music in South Florida's Jamaican community. Information for this study was obtained using participant observation, formal, and informal interviews. Participant observation was conducted over a 2 year period at several dancehall clubs and events throughout South Florida. A total of 24 formal and 30 informal interviews were conducted with listeners of the music and business owners who are directly and indirectly involved with the promotion, production, and distribution of dancehall in South Florida. ^ Results show that dancehall enacts cultural politics in three primary ways in South Florida. First, the music serves as one of several types of materials used in the construction of a "Jamaican identity." This is achieved through the lyrical content of the music where social, economic and political issues affecting the island are often discussed and debated. Second, dancehall operates as a form of cultural politics through its nurturing of nationalistic sensibilities. Evidence of this is apparent in the controversy involving dancehall's homophobic stance. Third, dancehall affords Jamaicans in South Florida the ability to transplant and perpetuate the uptown versus downtown divide. ^ Far from being wholly misogynistic and violent, therefore, dancehall is an important tool that can be used to address a wide variety of issues within the local Jamaican context and throughout the Jamaican diaspora. ^

A Dispersed People: Social and Cultural Dimensions of the Cuban Diaspora, Book Presentation with Volume Editor Jorge Duany

This flyer promotes the event "A Dispersed People: Social and Cultural Dimensions of the Cuban Diaspora, Book Presentation with Volume Editor Jorge Duany, comments by Lillian Manzor" sponsored by the School of International and Public Affairs at Florida International University. This event was held at Books and Books in Coral Gables.

A SENSIBILIDADE CULTURAL DO ADVENTISMO COMO MODELO MISSIOLÓGICO EM GRANDES CENTROS URBANOS: UMA ANÁLISE DE IGREJAS ADVENTISTAS ÉTNICAS NA CIDADE DE SÃO PAULO

Esta pesquisa objetiva analisar o desenvolvimento da missão adventista na cidade de São Paulo em busca de um modelo missiológico para centros urbanos. São Paulo, uma das maiores metrópoles do mundo tem uma formação cultural plural, não apenas pelas forças atuantes da modernização, secularização, globalização e pós-modernidade. A composição da população da cidade possui uma gênese étnica plural. Além da matriz autóctone indígena, do colonizador branco europeu e dos escravos africanos, desde o início do século XIX chegaram outros imigrantes, europeus e asiáticos. Nas primeiras décadas do século XX, o Brasil foi o país que mais recebeu imigrantes em todo o mundo. Estima-se que nos anos de 1920, apenas um terço da população na cidade de São Paulo fosse de brasileiros, o restante era composto por imigrantes. A inserção do adventismo em São Paulo se deu por missionários imigrantes que trabalharam primeiro com outros imigrantes antes de evangelizar e desenvolver a missão adventista com os brasileiros nacionais. De alguma forma, esse início deixou marcas na missão adventista paulistana. São Paulo é hoje a cidade com o maior número total de adventistas no mundo e a única com Igrejas Adventistas étnicas que atendem cinco grupos étnicos distintos: japoneses, coreanos, judeus, árabes e bolivianos/peruanos. Esta pesquisa busca investigar a formação de uma sensibilidade cultural no adventismo paulistano que lhe permitiu dialogar com a pluralidade cultural da metrópole paulistana

English Cathedrals: Events and Spiritual Capital

This paper investigates the recent trend for cathedrals in England to develop a wider and more ambitious scope to their event and activity programmes. It sets out to explore the types of events now hosted at cathedrals, to consider barriers to such ambitions and the opportunities presented by event programming to develop new audiences and grow attendances. The research focuses on the 42 Anglican cathedrals of England and has involved a review of recent reports published by church and cathedral organisations, supported by an in-depth review of event activity and objectives at five selected cathedrals in southern England. Despite declining general church attendance in England, cathedrals have enjoyed two decades of attendance growth both as places of worship and as tourist attractions, partly a reflection of a more complex contemporary search for multi-faceted types of spirituality. The paper explores how events can tap into the realm of individual spiritual capital and demonstrates the rich diversity of events now being hosted by cathedrals. The paper offers a new categorisation of ecclesiastical/liturgical events, cultural and community events and openly commercial event activity. Barriers remain but key facilitating factors have been new investment in event expertise and professionalism, encouragement to experiment by key funding bodies such as the Heritage Lottery Fund and the embracing of new forms of spirituality. The diversity of cathedral events reflects a new found growth in the nurturing of “spiritual capital” amongst both worshippers and tourists.

Service Quality in Arts Events: Operations Management Strategies for Effective Delivery

Recent debate on the quality of arts events has concentrated on the requirement to deliver against a complex range of political, social, and cultural criteria with an emphasis on the external partnerships that are forged. Yet those aspects of quality over which event organizers have more direct control have been accorded minor examination. The authors believe that operational effectiveness is key to service quality in the cultural context, and seek to demonstrate that a balanced consideration of both process and product is vital to fully deliver quality arts events. This article identifies areas of emergent research and practice and focuses on issues in the front-of-house environment where the breakdown of service quality is a real concern, using the experience of one UK not-for-profit arts organization as a case study to illustrate potential management responses.

“Animanazo”. Song and memories. Cultural expressions and movements in the reconstruction of the past inside a north Argentinian town

This article analyses the context of production and local situations of appropriation and resignification related to the folk song “Fire on Animaná” as well as the request and mobilization (“The animanazo”) provoked by this song in order to examine different mechanisms and foundations by which a population connect with an event from its community past, identifying with this and taking it in a specific way. In this article we combine discourse analysis of the song and of interviews to participants in this event with the reconstruction —through ethnographic observation— of how to use this song.

The Participation of Townspeople Making Music in Public Events in the Low Countries in the Fifteenth Century

Musicians, rhetoricians and crossbowmen, all of them employed by the city of Brussels, acted, sang and played instruments during the "Ommegang" procession in the 15th century in the main square, some of them during other processions, too. In Bruges, instrumentalists and singers took part in the representation of biblical scenes on street corners, which were part of the entry of Philip III the Good, Duke of Burgundy, into the city around the year 1440. The members of the clergy who knew music sang plainchant in all of these three roles, and independent musicians probably participated, too, even though the documents don't name them or describe their function. Except for the disabled, who marched in a procession on their own, the "common people" were only spectators of these events, which were planned in advance. The evidence that remains indicates that the voices of the "common people" remained hidden in these events, which were intended to promote civic unity.

O associativismo cultural e o impacto na educação artística contemporânea em Portugal : o caso da Associação Cultural d'Orfeu

As associações culturais, como coletividades que emancipam o papel do cidadão na criação e produção de atividades culturais, contribuindo para a dinamização das sociedades, podem ser um veículo de desenvolvimento da educação artística, ao nível do ensino não formal e informal, tendo como ponto de partida o contributo da participação ativa dos cidadãos, que buscam a promoção e dinamização de atividades de teor cultural e artístico. Sendo assim, a seleção do Associativismo Cultural para o estudo da evolução da educação artística é um caminho para a compreensão da dinâmica das coletividades e o seu impacto no desenvolvimento cultural e artístico, a nível local, regional e nacional. Neste estudo, foi selecionada a Associação Cultural d´Orfeu, como estudo de caso, pela sua longevidade como associação e pelo seu destaque a nível cultural e artístico da zona centro do país. Ao nível da metodologia optámos por uma metodologia mista, tanto numa abordagem qualitativa, ao nível da análise de conteúdo, como quantitativa, na análise de dados. As técnicas de recolha de dados consistiram em entrevistas a dirigentes associativos e colaboradores (metodologia qualitativa), inquéritos a sócios, colaboradores e participantes de associações culturais (metodologia quantitativa), registos para diário de campo (acontecimentos, atividades e formação artística), análise de espólio documental da Associação Cultural d´Orfeu e registo audiovisual e fotográfico. Com este estudo, espera-se compreender as dinâmicas que estão inerentes ao associativismo cultural ao nível da educação/formação artística e que impactos apresentam no desenvolvimento cultural, social e artístico da sociedade. Além disso, queremos verificar que estratégias são utilizadas pelas associações culturais para a diversificação da oferta cultural e para o incentivo da cidadania ativa.

Narrativa histórica: El legado de la novela Yo, El Supremo de Augusto Roa Bastos en la consolidación de la identidad cultural del Paraguay

La novela Yo, el Supremo del escritor paraguayo Augusto Roa Bastos* se basa en una figura histórica controversial y en los acontecimientos que rodearon a ese personaje. Aunque conocer los hechos más trascendentes de esa época no es indispensable para comprender el texto de la obra, la referencialidad histórica juega un papel importante en la narrativa del Supremo, pues en el proceso de desarrollo argumental de la obra él se nutre de ella para expresar ciertas ideas relacionadas, entre otras, con el concepto comunitario paraguayo. El personaje se mueve dentro de una macro-temporalidad. No obstante, hay una sistemática referencia a una época determinada que sobresale en su discurso. La referencialidad histórica está así funcionando como un marcador temporal y, al mismo tiempo, señala que el discurso de el Supremo es portador de ciertos valores correspondientes a esa época. Los conceptos socio-políticos que maneja el personaje no son abstractos sino que se identifican con el ser paraguayo del siglo XIX.AbstractThe novel Yo, el Supremo, by Paraguayan writer Augusto Roa Bastos, is based on a historical and controversial character and on the facts that surrounded this character. Even though it is not important to know the most important events of that time to understand the text, the historical references play an important role in the narrative of the Supremo because in the process of the argumentative development he is nourished from those references in order to express some ideas related, among others, with the communal Paraguayan concept. The character moves inside a macro-temporal level. However, there is systematic reference to a specific epoch that is highlighted in his discourse. The historical references thus works as a temporal marker and, at the same time, reveals that the discourse of the Supremo contains some values that correspond to that time. The socio-political concepts that the character works with are not abstract but rather show the Paraguayan identity of the XX century.

El patrimonio cultural tangible e intangible articulado a la ordenación territorial aplicado al caso del cantón Paltas provincia de Loja

En el Ecuador la base legal como la Constitución del 2008 y el Código Orgánico de Organización Territorial, Autonomía y descentralización (COOTAD), establecen la organización político administrativa del territorio en diferentes niveles de gobierno, sean estos regiones, provincias, cantones, parroquias rurales y también de régimen especial, para ello estos niveles adquieren funciones de integridad para realizar legislación, ejecución, fiscalización y de participación ciudadana, en donde se alcanzará y se promoverá el desarrollo sustentable en el marco del plan nacional del buen vivir. Para lograr este legado, los diferentes Gobiernos Autónomos Descentralizados deben elaborar y ejecutar el Plan de Ordenamiento Territorial (POT) y el Plan de Desarrollo y Ordenamiento Territorial (PDOT), de acuerdo a sus competencias de circunscripción territorial. Por competencia exclusiva les corresponde a los gobiernos municipales " formular, aprobar y evaluar los planes, programas y proyectos destinados a la preservación, mantenimiento y difusión del patrimonio arquitectónico, cultural y natural de su circunscripción..... Para el efecto, el patrimonio en referencia será considerado en todas sus expresiones tangibles e intangible...” (COOTAD Art. 144). Lamentablemente la mayoría de estos gobiernos municipales poco o nada han incorporado el patrimonio cultural tangible e intangible en sus fases de análisis de, diagnóstico, propuesta y modelo gestión. Como base fundamental tomaremos la guía metodológica para la elaboración de planes de desarrollo y ordenamiento que presenta la SENPLADES en el año 2014y la propuesta que realiza el Dr. Domingo Gómez Orea en su libro Ordenación Territorial 2da edición, de ahí se propone una alternativa metodológica de articulación del patrimonio cultural y ordenamiento territorial. Y para lograr este objetivo, utilizaremos la información disponible que cuenta el Instituto nacional de Patrimonio Cultural (INPC) en su sistema informatizado que se encuentra en la página Web www.inpc.gob.ec, denominado Sistema de Información Patrimonial Cultural del Ecuador (SIPCE), esta base de información que contiene fichas de inventario en sus diferentes ámbitos culturales como inmuebles, muebles, documentos. Arqueológicos y manifestaciones inmateriales, previamente analizadas y georreferenciadas nos permitirán territorializar en el espacio cantonal y con ello poder realizar un análisis integrado con los otros componentes como es el medio físico, poblacional, económico, núcleos de población etc. Esta nueva metodología permitirá visualizar, conocer, aprender y empodéranos del patrimonio cultural material e inmaterial, con aquellas manifestaciones culturales y tradicionales que existen y se encuentran en vigencia. También poder recuperar y rescatar aquellas que están en peligro de desaparecer, este potencial cultural será una gran posibilidad de generar emprendimientos y desarrollo sustentable. La manera más idónea de concretar y fomentar este desarrollo sustentable en territorio será a través de la formulación de programas, planes y proyectos que deberán plantearse en los planes de ordenamiento territorial y los planes de desarrollo territorial. Finalmente para comprobar esta nueva propuesta metodológica de articulación entre el patrimonio cultural y el ordenamiento territorial, la aplicaremos al cantón Paltas de la provincia de Loja.

Tradução para a língua portuguesa e adaptação cultural do questionário Rowe modificado para atletas arremessadores

OBJECTIVE: Study was to translate and culturally adapt the modified Rowe score for overhead athletes. METHODS: The translation and cultural adaptation process initially involved the stages of transla tion, synthesis, back-translation, and revision by the Translation Group. It was than created the pre-final version of the question naire, being the areas function and pain applied to 20 athletes that perform overhead movements and that suffered SLAP lesions in the dominant shoulder and the areas active compression test and anterior apprehension test and motion were applied to 15 health professionals. RESULTS: During the translation process there were made little modifications in the questionnaire in order to adapt it to Brazilian culture, without changing the semantics and the idiomatic concept originally described. CONCLUSIONS: The questionnaire was easily understood by the subjects of the study, being possible to obtain the Brazilian version of the modified Rowe score for over head athletes that underwent surgical treatment of the SLAP lesion.

Pesquisa qualitativa em Educação Física: possibilidades de construção de conhecimento a partir do referencial cultural

This work indicates presuppositions for the qualitative research in Physical Education, starting with a literature review based on the cultural frame of reference. Firstly, we introduce the debate concerning the natural and the human sciences and implications for the Physical Education; we then use a cultural axis as a ground basis for the research in the area, proposing the 'dense description' as a possibility for knowledge building; finally, we bring up examples of studies conducted with such an approach. This theoretical methodological approach allows the study of the human being as a cultural being, thus opposed to the naturalised view of a human - predominant in Physical Education.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.