Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
Contribuinte(s) |
Universidade Estadual de Campinas |
---|---|
Data(s) |
01/02/2011
03/12/2015
03/12/2015
|
Resumo |
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects. O fungo Metarhizium anisopliae é usado em larga escala no Brasil como um agente de controle microbiológico contra a cigarrinha da cana-de-açúcar, Mahanarva posticata e M. fimbriolata (Hemiptera, Cercopidae). Aplicou-se a linhagem E9 de M. anisopliae em bioensaio no solo, nas dosagens de campo, para se determinar se este poderia causar infecção, doença e morte a estágios imaturos de Anastrepha fraterculus, a mosca sul-americana das frutas. Todos os eventos foram estudados histologicamente e ao nível molecular durante o ciclo da doença, usando-se uma nova técnica de coloração, o corante light Green, associado com a microscopia de luz, e a técnica do PCR, usando-se primers específicos desenvolvidos para M. anisopliae linhagens brasileiras, entre elas a E9. O ciclo infectivo, que se inicia pela adesão do conídio sobre a cutícula do hospedeiro, seguido da germinação, com ou sem a formação de apressório, penetração através da cutícula, colonização, com desenvolvimento da fase dimórfica, corpos hifais na hemocela com a morte do hospedeiro, dura 96 horas, nas condições do bioensaio, similar às condições de campo. Durante o ciclo da doença, propágulos do fungo entomopatogênico foram detectados pela identificação do DNA com primer específico ITSMet: 5'TCTGAATTTTTTATAAGTAT3' com o ITS4 (5'TCCTCCGCTTATTGATATGC3') como primer reverso. Esta metodologia simples permite o estudo in situ do processo infectivo, contribuindo com o entendimento da relação entre patógeneo hospedeiro e permitindo o monitoramento da eficácia e sobrevivência deste fungo entomopatogênico em aplicações em larga escala no campo. Esta também permite e facilita o monitoramento do impacto de M. anisopliae sobre insetos não alvos. 91 98 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) |
Identificador |
Brazilian Journal of Biology. Instituto Internacional de Ecologia, v. 71, n. 1, p. 91-98, 2011. 1519-6984 S1519-69842011000100014 10.1590/S1519-69842011000100014 http://dx.doi.org/10.1590/S1519-69842011000100014 http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1519-69842011000100014 http://www.repositorio.unicamp.br/jspui/handle/REPOSIP/35151 |
Idioma(s) |
en |
Publicador |
Instituto Internacional de Ecologia |
Relação |
Brazilian Journal of Biology |
Direitos |
aberto |
Fonte |
SciELO |
Palavras-Chave | #Metarhizium anisopliae #controle de moscas das frutas #histologia #análise de PCR #Metarhizium anastrepha #fruit fly control #histology #PCR analysis |
Tipo |
Artigo de periódico |