1000 resultados para Ácido alfa-cetoisocapróico
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Objetivou-se neste trabalho estudar o efeito do ácido indolbutírico (AIB) e do ácido bórico (B) no enraizamento de estacas de Ginkgo biloba. em estacas com duas folhas, medindo 15 cm de comprimento foram provocadas duas lesões na base de aproximadamente 2 cm, expondo o câmbio e procedeu-se à imersão por 10 segundos no tratamento correspondente, AIB (0, 1000, 2000 e 3000 mg L-1) na ausência ou presença de B (0 e 150 mg L-1). em seguida foram colocadas para enraizar em bandejas de polipropileno contendo areia lavada. O delineamento foi em blocos casualizados num fatorial 4X2, com seis repetições. Foram avaliadas porcentagem de estacas enraizadas, estacas não enraizadas e mortas, diâmetro e comprimento das raízes, aos 70 dias do tratamento. Os dados foram submetidos à análise de variância sendo previamente testados para normalidade pelo Teste de Shapiro-Wilk. As médias foram comparadas pelo Teste de Tukey. Os tratamentos com 2000 mg L-1 de AIB foram superiores à ausência de AIB (80,55% vs. 55,56%, respectivamente), não diferindo dos demais tratamentos. A utilização de B não afetou a taxa de enraizamento, de estacas não enraizadas e mortas, não havendo interação entre a concentração de AIB e a utilização ou não de B. O diâmetro e o comprimento das raízes não foram afetados pela utilização de AIB e B.
Resumo:
This work aimed to increase the rhizogenic potential of cuttings collected from the apical portion of the branches of fig trees, performing injuries and treating the cuttings with indolbutyric acid (IBA). Apical cuttings of 'Roxo de Valinhos' fig tree were collected in July. The cuttings were standardized with 20 cm in length and basal diameter of 10 mm. The cuttings received or not incisions at the basis (parallel cuts of 2 cm) and immersed in IBA at 0, 1000, 2000 and 3000 mg L(-1) for 10 seconds. The cuttings were buried (3/4 of the length) in moistened sand, inside a screen house (50% of light). After 60 days it was found that treatment with IBA benefits in the development of apical cuttings, and the concentration that achieved the best results was 2000 mg L(-1); the use of injury at the base of the cuttings helps rooting.
Resumo:
The dried beef is a food traditionally eaten by Northeastern and has an extensive trade in the city of Natal-RN. It is usually produced in an empirical manner, without any standardization in production. Characterized as partially dehydrated meat product, so that the activity of water present is not sufficient to prevent microbial growth, degradation or the production of microbial toxins. The guarantee that the market dried beef is to provide a quality product hygienic, microbiological, physicochemical and sensory stable and adequate for the safety and consumer satisfaction, which has been increasingly attracted to food with natural preservatives. Thus, the meat industries are replacing the current seasonings and natural preservatives for similar, with it without affecting the shelf life of products. Lactic acid has been used to meet these requirements. In this sense, this study aimed to evaluate the effect of lactic acid on the physico-chemical, microbiological and sensory, besides knowing the consumer profile of dried meat of the City of Natal / RN. The results demonstrated that the use of lactic acid in concentrations of 1% and 2% during the processing of dried meat, had statistically significant effect (p < 0.05) on the physico-chemical (pH and water activity) and consequently reduced the microbial count does not alter the taste of the new product developed. Regarding the results on the consumer profile, it was found that the majority of respondents (71.75%) did not observe the presence of the stamp of the Federal Inspection Service (SIF) to buy this meat food that 81.55% of consumers check the hygiene conditions of the site and handlers, however, a large proportion of respondents not concerned with the guarantee of origin of typical regional products featuring a hazard to food safety for consumers of the city of Natal-RN
Resumo:
Among the heterogeneous catalysts materials made from niobium show up as an alternative to meet the demand of catalysts for biodiesel production. This study aims to evaluate the potential of a heterogeneous catalyst derived from a complex of niobium in the reaction of methyl esterification of oleic acid. The catalyst was synthesized after calcination at different temperatures of a niobium complex ((NH4)3[NbO(C2O4)3].H2O) generating a niobium oxide nanostructure with a different commercial niobium oxide used to synthesize the complex. The commercial niobium oxide, the complex niobium and niobium catalyst were characterized by thermogravimetry (TG and DTA), surface area analysis (BET), scanning electron microscopy (SEM) and X-ray diffraction (XRD), showing the catalyst has researched morphological and crystallographic indicating a catalytic potential higher than that of commercial niobium oxide characteristics. Factorial with central composite design point, with three factors (calcination temperature, molar ratio of alcohol/oleic acid and mass percentage of catalyst) was performed. Noting that the optimal experimental point was given by the complex calcination temperature of 600°C, a molar ratio alcohol/oleic acid of 3.007/1 and the catalyst mass percentage of 7.998%, with a conversion of 22.44% oleic acid in methyl oleate to 60 min of reaction. We performed a composite linear and quadratic regression to determine an optimal statistical point of the reaction, the temperature of calcination of the complex at 450°C, the molar ratio of alcohol/oleic acid 3.3408/1 and mass percentage of catalyst of 7.6833% . Kinetic modeling to estimate parameters for heterogeneous catalysis it set well the experimental results with a final conversion of 85.01% with 42.38% of catalyst and without catalyst at 240 min reaction was performed. Allowing to evaluate the catalyst catalytic studied has the potential to be used in biodiesel production
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
A agregação plaquetária avalia a função das plaquetas através de diferentes vias de ativação plaquetária in vitro, fornecendo traçados de ondas equivalentes à propriedade física dessa agregação. Sabendo-se que a aspirina acetila irreversivelmente a enzima cicloxigenase prevenindo a geração de tromboxana A2, potente ativador da agregação plaquetária, esta droga tem sido analisada há mais de trinta anos na clínica médica em pacientes com doenças cardiovasculares como uma potente droga antitrombótica. Foram nossos objetivos obter traçados de ondas correspondentes às fases da agregação plaquetária para nossa padronização utilizando nosso grupo controle de doadores de sangue e compará-las com nosso grupo estudo, frente a diferentes agentes agonistas em diferentes concentrações: ADP 1µM e 3µM; AA, 0,5mM; ADR, 0,05 mg/mL, 0,025 mg/mL e 0,010 mg/mL. Os grupos analisados foram constituídos por 41 cardíacos e 40 doadores de sangue considerados controle. Dos cardíacos, 33 faziam uso regular do AAS na concentração de 200 mg/dia e oito na concentração de 100 mg/dia, sendo todos considerados hipertensos. A padronização da agregometria estava na dependência do encontro de traçados correspondentes a ondas de agregação, sendo esses obtidos em porcentagem no tempo de cinco minutos estandartizados pelo aparelho utilizado. Comparando os resultados entre os pacientes e o grupo controle, foi possível observar que, na presença dos agentes agregantes ADP 1µM e ADP 3 µM, ADR 0,05 mg/mL, 0,025mg/mL e 0,010 mg/mL, os pacientes apresentaram 1ª onda, mas não 2ª onda. Por sua vez, no caso do AA 0,5 mM não houve o encontro de traçados de ondas.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Estudou-se o comportamento biológico e histopatológico de uma cepa genuínamente mariliense de Trypanosoma cruzi, isolada em 1997 através de xenodiagnóstico artificial. Vinte e cinco camundongos swiss foram infectados intraperitonealmente, sendo 11 utilizados para a realização da curva parasitêmica e observação da morfologia dos tripomastigotas e 14 foram sacrificados após o 17, 23, 30, 60 e 180 dias pós-infecção e coletados coração, esôfago, fígado, cólon, e músculo esquelético (fragmento da coxa direita) para análise histopatológica. Cultura em meio LIT foi realizada para análise de DNA. Os resultados mostraram predomínio de formas largas, baixa parasitemia com picos médios de 860 tripomastigotas/5mil de sangue ao redor do 20º dia de infecção. Nenhum camundongo morreu na fase aguda da infecção. Exame histopatológico mostrou poucos ninhos de amastigotas em coração, raros em músculo esquelético e cólon com discreto processo inflamatório. Comparada com a cepa Y, que foi isolada de uma paciente da mesma região, notamos diferentes características biológicas e comportamentais, porém a análise de DNA as coloca no mesmo grupo, demonstrando a proximidade dessas cepas.
Resumo:
Activation of the kynurenine (KYN) pathway (KP) by modulators of immune system has been observed during several neurological diseases. Here we assessed the association of chemo-/cytokine levels with the concentration of KP metabolites in cerebrospinal fluid (CSF) and plasma samples from patients with bacterial meningitis (BM). All samples were collected from 42 patients diagnosed with acute bacterial meningitis (ABM), aseptic meningitis, tuberculous meningitis and patients without infection neurological disorders. CSF and plasma concentration of metabolites from the KP was assessed by high pressure liquid chromatography (HPLC) and cytokines and chemokines by Bio-plex 200 suspension array system. Concentrations of the KP metabolites KYN and kynurenic acid (KYNA) were significantly higher in CSF of patients with ABM compared to other groups. Tryptophan (TRP), anthranilic acid (AA), 3-hydroxykynurenine (3HK) and 3-hydroxyanthranilic acid (3HAA) did not show statistical significance, although some of them presented a good accumulation during ABM. The expression of TNF-alpha, IL-6, IL-1beta, IFN-gamma, IL-10, IL-1 receptor antagonist (IL-1Ra), MIP-1alpha, MIP-1beta, MCP-1 and G-CSF was about 100-fold higher in CSF from ABM patients than other infected groups. In all CSF and plasma samples, the concentration of IL-2, IL-12(p70), IL-4, IL-8 and GM-CSF was not significant. ABM still showed significant concentrations of IL-6, IL-10, IL-1Ra and MCP-1 in plasma samples. Based on the comparison of KP metabolites concentrations between plasma and CSF samples we conclude that the activation of the tryptophan pathway upon BM occurs within the brain. This increase in KP metabolites is most due to activation of the KP by molecules as IFN-gamma and TNF-alpha in response to infection.
Resumo:
Autism comprises a heterogeneous group of neurodevelopmental disorders that affects the brain maturation and produces sensorial, motor, language and social interaction deficits in early childhood. Several studies have shown a major involvement of genetic factors leading to a predisposition to autism, which are possibly affected by environmental modulators during embryonic and post-natal life. Recent studies in animal models indicate that alterations in epigenetic control during development can generate neuronal maturation disturbances and produce a hyper-excitable circuit, resulting in typical symptoms of autism. In the animal model of autism induced by valproic acid (VPA) during rat pregnancy, behavioral, electrophysiological and cellular alterations have been reported which can also be observed in patients with autism. However, only a few studies have correlated behavioral alterations with the supposed neuronal hyper-excitability in this model. The aim of this project was to generate an animal model of autism by pre-natal exposure to VPA and evaluate the early post-natal development and pre-puberal (PND30) behavior in the offspring. Furthermore, we quantified the parvalbumin-positive neuronal distribution in the medial prefrontal cortex and Purkinje cells in the cerebellum of VPA animals. Our results show that VPA treatment induced developmental alterations, which were observed in behavioral changes as compared to vehicle-treated controls. VPA animals showed clear behavioral abnormalities such as hyperlocomotion, prolonged stereotipies and reduced social interaction with an unfamiliar mate. Cellular quantification revealed a decrease in the number of parvalbumin-positive interneurons in the anterior cingulate cortex and in the prelimbic cortex of the mPFC, suggesting an excitatory/inhibitory unbalance in this animal model of autism. Moreover, we also observed that the neuronal reduction occurred mainly in the cortical layers II/III and V/VI. We did not detect any change in the density of Purkinje neurons in the Crus I region of the cerebellar cortex. Together, our results strengthens the face validity of the VPA model in rats and shed light on specific changes in the inhibitory circuitry of the prefrontal cortex in this autism model. Further studies should address the challenges to clarify particular electrophysiological correlates of the cellular alterations in order to better understand the behavioral dysfunctions
Resumo:
Corrosion inhibition efficiency of saponified coconut oil (SCO) and sodium dodecilbenzene sulfonate (DBS) surfactants in AISI 1020 carbon steel was evaluated by electrochemical methods. These surfactants were also evaluated as microemulsion systems (SCO-ME and DBS-ME), of O/W type (water-rich microemulsion), in a Winsor IV region. They were obtained according to the following composition: 15% SCO, 15% butanol (30% Co-surfactant/Surfactant C/T), 10% organic phase (FO, kerosene) and 60% aqueous phase (FA). These systems were also used to solubilize the following nitrogenated substances: Diphenylcarbazide (DC), 2,4-dinitro-phenyl-thiosemicarbazide (TSC) and the mesoionic type compound 1,3,4-triazolium-2-thiolate (MI), that were investigated with the purpose of evaluating their anticorrosive effects. Comparative studies of carbon steel corrosion inhibition efficiencies of free DBS and DBS-ME, in brine and acidic media (0.5%), showed that DBS presents better inhibition results in acidic media (free DBS, 89% and DBS-ME, 93%). However, the values obtained for DBS in salted solution (72% free DBS and 77% DBS-ME) were similar to the ones observed for the SCO surfactant in brine (63% free SCO and 74% SCO-ME). Analysis of corrosion inhibition of the nitrogenated substances that were solubilized in the SCO-ME microemulsion system by the linear polarization method in brine (0.5% NaCl) showed that such compounds are very efficient an corrosion inhibitors [DC-ME-SCO (92%), TSC-ME-SCO (93%) and MI-ME-SCO (94%)]
Resumo:
The present study describes the stability and rheological behavior of suspensions of poly (N-isopropylacrylamide) (PNIPAM), poly (N-isopropylacrylamide)-chitosan (PNIPAMCS), and poly (N-isopropylacrylamide)-chitosan-poly (acrylic acid) (PNIPAM-CS-PAA) crosslinked particles sensitive to pH and temperature. These dual-sensitive materials were simply obtained by one-pot method, via free-radical precipitation copolymerization with potassium persulfate, using N,N -methylenebisacrylamide (MBA) as a crosslinking agent. Incorporation of the precursor materials into the chemical networks was confirmed by elementary analysis and infrared spectroscopy. The influence of external stimuli such as pH and temperature, or both, on particle behavior was investigated through rheological measurements, visual stability tests and analytical centrifugation. The PNIPAM-CS particles showed higher stability in acid and neutral media, whereas PNIPAM-CS-PAA particles were more stable in neutral and alkaline media, both below and above the LCST of poly (Nisopropylacrylamide) (stability data). This is due to different interparticle interactions, as well as those between the particles and the medium (also evidenced by rheological data), which were also influenced by the pH and temperature of the medium. Based on the results obtained, we found that the introduction of pH-sensitive polymers to crosslinked poly (Nisopropylacrylamide) particles not only produced dual-sensitive materials, but allowed particle stability to be adjusted, making phase separation faster or slower, depending on the desired application. Thus, it is possible to adapt the material to different media
Resumo:
In this paper, the technique of differential pulse voltammetry (DPV) has been studied for monitoring the concentration of oxalic acid (OA) during their electrochemical oxidation (EO) in acidic medium using platinum anode supported on titanium (Ti / Pt). The DPV was standardized and optimized using a glassy carbon electrode modified with cysteine. The modification with cysteine was developed electrochemically, forming a polymeric film on the surface of the glassy carbon electrode. The formation of the polymer film was confirmed by analysis of scanning electron microscope and atomic force microscope, confirming the modification of the electrode. The electrochemical degradation was developed using different current densities 10, 20 30 and 40 mA cm -2 electrode with Ti / Pt observing the degradation of oxalic acid, and monitored using the method of KMnO4 titration. However, the analyzes with DPV showed the same behavior elimination of oxalic acid titration. Compared with the titration method classical observed and DPV could be a good fit, confidence limits of detection and confirming the applicability of the technique electroanalytical for monitoring the degradation of oxalic acid