The challenges of integrating biodiversity and ecosystem services monitoring and evaluation at a landscape-scale wetland restoration project in the UK

There is an increasing emphasis on the restoration of ecosystem services as well as of biodiversity, especially where restoration projects are planned at a landscape scale. This increase in the diversity of restoration aims has a number of conceptual and practical implications for the way that restoration projects are monitored and evaluated. Landscape-scale projects require monitoring of not only ecosystem services and biodiversity but also of ecosystem processes since these can underpin both. Using the experiences gained at a landscape-scale wetland restoration project in the UK, we discuss a number of issues that need to be considered, including the choice of metrics for monitoring ecosystem services and the difficulties of assessing the interactions between ecosystem processes, biodiversity, and ecosystem services. Particular challenges that we identify, using two pilot data sets, include the decoupling of monetary metrics used for monitoring ecosystem services from biophysical change on the ground and the wide range of factors external to a project that influence the monitoring results. We highlight the fact that the wide range of metrics necessary to evaluate the ecosystem service, ecosystem process, and biodiversity outcomes of landscape-scale projects presents a number of practical challenges, including the need for high levels of varied expertise, high costs, incommensurate monitoring outputs, and the need for careful management of monitoring results, especially where they may be used in making decisions about the relative importance of project aims.

Integrated indicator framework and methodology for monitoring and assessment of hazardous substances and their effects in the marine environment

Many maritime countries in Europe have implemented marine environmental monitoring programmes which include the measurement of chemical contaminants and related biological effects. How best to integrate data obtained in these two types of monitoring into meaningful assessments has been the subject of recent efforts by the International Council for Exploration of the Sea (ICES) Expert Groups. Work within these groups has concentrated on defining a core set of chemical and biological endpoints that can be used across maritime areas, defining confounding factors, supporting parameters and protocols for measurement. The framework comprised markers for concentrations of, exposure to and effects from, contaminants. Most importantly, assessment criteria for biological effect measurements have been set and the framework suggests how these measurements can be used in an integrated manner alongside contaminant measurements in biota, sediments and potentially water. Output from this process resulted in OSPAR Commission (www.ospar.org) guidelines that were adopted in 2012 on a trial basis for a period of 3 years. The developed assessment framework can furthermore provide a suitable approach for the assessment of Good Environmental Status (GES) for Descriptor 8 of the European Union (EU) Marine Strategy Framework Directive (MSFD).

Infrared thermography monitoring of the NaCl crystallisation process

In this work, we describe the growth of NaCl crystals by evaporating droplets of aqueous solution while monitoring them with infrared thermography. Over the course of the evaporation experiments, variations in the recorded signal were observed and interpreted as being the result of evaporation and crystallisation. In particular, we observed sharp and transient decreases in the thermosignal during the later stages of high-concentration drop evaporation. The number of such events per experiment, referred to as “pop-cold events”, varied from 1 to over 100 and had durations from 1 to 15 s. These events are interpreted as a consequence from the top-supplied creeping (TSC) of the solution feeding the growth of efflorescence-like crystals. This phenomenon occurred when the solution was no longer macroscopically visible. In this case, efflorescence-like crystals with a spherulite shape grew around previously formed cubic crystals. Other crystal morphologies were also observed but were likely fed by mass diffusion or bottom-supplied creeping (BSC) and were not associated with “pop-cold events”; these morphologies included the cubic crystals at the centre, ring-shaped at the edge of droplets and fan-shaped crystals. After complete evaporation, an analysis of the numbers and sizes of the different types of crystals was performed using image processing. Clear differences in their sizes and distribution were observed in relation to the salt concentration. Infrared thermography permitted a level of quantification that previously was only possible using other techniques. As example, the intermittent efflorescence growth process was clearly observed and measured for the first time using infrared thermography.

Novel Analytical Methodologies for the Monitoring of Traditional and Non-traditional Pollutants in different Environmental Compartments of South Florida

Routine monitoring of environmental pollution demands simplicity and speed without sacrificing sensitivity or accuracy. The development and application of sensitive, fast and easy to implement analytical methodologies for detecting emerging and traditional water and airborne contaminants in South Florida is presented. A novel method was developed for quantification of the herbicide glyphosate based on lyophilization followed by derivatization and simultaneous detection by fluorescence and mass spectrometry. Samples were analyzed from water canals that will hydrate estuarine wetlands of Biscayne National Park, detecting inputs of glyphosate from both aquatic usage and agricultural runoff from farms. A second study describes a set of fast, automated LC-MS/MS protocols for the analysis of dioctyl sulfosuccinate (DOSS) and 2-butoxyethanol, two components of Corexit®. Around 1.8 million gallons of those dispersant formulations were used in the response efforts for the Gulf of Mexico oil spill in 2010. The methods presented here allow the trace-level detection of these compounds in seawater, crude oil and commercial dispersants formulations. In addition, two methodologies were developed for the analysis of well-known pollutants, namely Polycyclic Aromatic Hydrocarbons (PAHs) and airborne particulate matter (APM). PAHs are ubiquitous environmental contaminants and some are potent carcinogens. Traditional GC-MS analysis is labor-intensive and consumes large amounts of toxic solvents. My study provides an alternative automated SPE-LC-APPI-MS/MS analysis with minimal sample preparation and a lower solvent consumption. The system can inject, extract, clean, separate and detect 28 PAHs and 15 families of alkylated PAHs in 28 minutes. The methodology was tested with environmental samples from Miami. Airborne Particulate Matter is a mixture of particles of chemical and biological origin. Assessment of its elemental composition is critical for the protection of sensitive ecosystems and public health. The APM collected from Port Everglades between 2005 and 2010 was analyzed by ICP-MS after acid digestion of filters. The most abundant elements were Fe and Al, followed by Cu, V and Zn. Enrichment factors show that hazardous elements (Cd, Pb, As, Co, Ni and Cr) are introduced by anthropogenic activities. Data suggest that the major sources of APM were an electricity plant, road dust, industrial emissions and marine vessels.

Seasonal dynamics and operational monitoring of hedgerow olive tree transpiration in response to applied water

We used 2012 sap flow measurements to assess the seasonal dynamics of daily plant transpiration (ETc) in a high-density olive orchard (Olea europaea L. cv. ‘Arbequina’) with a well-watered (HI) control treatment A to supply 100 % of the crop water needs, and a moderately (MI) watered treatment B that replaced 70% of crop needs. To assure that treatment A was well-watered, we compared field daily ETc values against ETc obtained with the Penman-Monteith (PM) combination equation incorporating the Orgaz et al. (2007) bulk daily canopy conductance (gc) model, validated for our non-limiting conditions. We then tested the hypothesis of indirectly monitoring olive ETc from readily available vegetation index (VI) and ground-based plant water stress indicator. In the process we used the FAO56 dual crop coefficient (Kc) approach. For the HI olive trees we defined Kcb as the basal transpiration coefficient, and we related Kcb to remotely sensed Soil Adjusted Vegetation Index (SAVI) through a Kcb-SAVI functional relationship. For the MI treatment, we defined the actual transpiration ETc as the product of Kcb and the stress reduction coefficient Ks obtained as the ratio of actual to crop ETc, and we correlated Ks with MI midday stem water potential (ψst) values through a Ks-ψ functional relationship. Operational monitoring of ETc was then implemented with the ETc = Kcb(SAVI)Ks(ψ)ETo relationship stemmed from the FAO56 approach and validated taking as inputs collected SAVI and ψst data reporting to year 2011. Low validation error (6%) and high goodness-of-fit of prediction were observed (R2 = 0.94, RSME = 0.2 mm day-1, P = 0.0015), allowing to consider that under field conditions it is possible to predict ETc values for our hedgerow olive orchards if SAVI and water potential (ψst) values are known.

Evaluation of DUALEM, OptRx and Grassmaster II sensors for monitoring the spatial variability and the temporal stability of a Mediterranean pasture

Site-specific management (SSM) is a form of precision agriculture whereby decisions on resource application and agronomic practices are improved to better match soil and crop requirements as they vary in the field. SSM enables the identification of regions (homogeneous management zones) within the area delimited by field boundaries. These subfield regions constitute areas that have similar permanent characteristics. Traditional soil and pasture sampling and the necessary laboratory analysis are time-consuming, labour-intensive and cost prohibitive, not viable from a SSM perspective because it needs a large number of soil and pasture samples in order to achieve a good representation of soil properties, nutrient levels and pasture quality and productivity. The main objective of this work was to evaluate technologies which have potential for monitoring aspects related to spatial and temporal variability of soil nutrients and pasture green and dry matter yield (respectively, GM and DM, in kg/ha) and support to decision making for the farmer. Three types of sensors were evaluated in a 7ha pasture experimental field: an electromagnetic induction sensor (“DUALEM 1S”, which measures the soil apparent electrical conductivity, ECa), an active optical sensor ("OptRx®", which measures the NDVI, “Normalized Difference Vegetation Index”) and a capacitance probe ("GrassMaster II" which estimates plant mass). The results indicate the possibility of using a soil electrical conductivity probe as, probably, the best tool for monitoring not only some of the characteristics of the soil, but also those of the pasture, which could represent an important help in simplifying the process of sampling and support SSM decision making, in precision agriculture projects. On the other hand, the significant and very strong correlations obtained between capacitance and NDVI and between any of these parameters and the pasture productivity shows the potential of these tools for monitoring the evolution of spatial and temporal patterns of the vegetative growth of biodiverse pasture, for identifying different plant species and variability in pasture yield in Alentejo dry-land farming systems. These results are relevant for the selection of an adequate sensing system for a particular application and open new perspectives for other works that would allow the testing, calibration and validation of the sensors in a wider range of pasture production conditions, namely the extraordinary diversity of botanical species that are characteristic of the Mediterranean region at the different periods of the year.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Análise do perfil de humor e da enzima alfa-amilase salivar em indivíduos fisicamente ativos = : Analysis of profile of mood states and salivary alpha amylase enzyme in physically active individuals

Universidade Estadual de Campinas . Faculdade de Educação Física

Influence of specimens' design and manufacturing process on microtensile bond strength to enamel: laboratory and FEA comparison

This study evaluated the effect of specimens' design and manufacturing process on microtensile bond strength, internal stress distributions (Finite Element Analysis - FEA) and specimens' integrity by means of Scanning Electron Microscopy (SEM) and Laser Scanning Confocal Microscopy (LCM). Excite was applied to flat enamel surface and a resin composite build-ups were made incrementally with 1-mm increments of Tetric Ceram. Teeth were cut using a diamond disc or a diamond wire, obtaining 0.8 mm² stick-shaped specimens, or were shaped with a Micro Specimen Former, obtaining dumbbell-shaped specimens (n = 10). Samples were randomly selected for SEM and LCM analysis. Remaining samples underwent microtensile test, and results were analyzed with ANOVA and Tukey test. FEA dumbbell-shaped model resulted in a more homogeneous stress distribution. Nonetheless, they failed under lower bond strengths (21.83 ± 5.44 MPa)c than stick-shaped specimens (sectioned with wire: 42.93 ± 4.77 MPaª; sectioned with disc: 36.62 ± 3.63 MPa b), due to geometric irregularities related to manufacturing process, as noted in microscopic analyzes. It could be concluded that stick-shaped, nontrimmed specimens, sectioned with diamond wire, are preferred for enamel specimens as they can be prepared in a less destructive, easier, and more precise way.

In vitro analysis of thermocompaction time and gutta-percha type on quality of main canal and lateral canals filling

The aim of this study was to evaluate the quality of filling in main and lateral root canals performed with the McSpadden technique, regarding the time spent on the procedure and the type of gutta-percha employed. Fifty simulated root canals, made with six lateral canals placed two apiece in the cervical, middle and apical thirds of the root, were divided into 5 groups. Group A: McSpadden technique with conventional gutta-percha, performed with sufficient time for canal filling; Group B: McSpadden technique with conventional gutta-percha, performed in twice the mean time used in Group A; Group C: McSpadden technique with TP gutta-percha, performed with sufficient time for canal filling; Group D: McSpadden technique with TP gutta-percha, performed in twice the mean time used in Group C; Group E: lateral condensation technique. Images of the filled root canals were taken using a stereomicroscope and analyzed using the Leica QWIN Pro software for filling material flow, gutta-percha filling extension and sealer flow. Data were analyzed by analysis of variance (ANOVA) and Tukey test (p < 0.05). The best values of penetration in lateral canals in the middle third occurred in the groups where TP gutta-percha was used. However, in the apical third, group B showed the best values. Although a longer time of compactor use allows greater penetration of the filling material into the lateral canals, the presence of voids resulted in bad quality radiographic images, suggesting porosity. The best quality of filling material was observed in Group A (McSpadden technique with conventional Gutta-Percha, performed with sufficient time for root canal filling).

A feasibility study of cell phone and landline phone interviews for monitoring of risk and protection factors for chronic diseases in Brazil

The study objective was to evaluate the feasibility of interviews by cell phone as a complement to interviews by landline to estimate risk and protection factors for chronic non-communicable diseases. Adult cell phone users were evaluated by random digit dialing. Questions asked were: age, sex, education, race, marital status, ownership of landline and cell phones, health condition, weight and height, medical diagnosis of hypertension and diabetes, physical activity, diet, binge drinking and smoking. The estimates were calculated using post-stratification weights. The cell phone interview system showed a reduced capacity to reach elderly and low educated populations. The estimates of the risk and protection factors for chronic non-communicable diseases in cell phone interviews were equal to the estimates obtained by landline phone. Eligibility, success and refusal rates using the cell phone system were lower than those of the landline system, but loss and cost were much higher, suggesting it is unsatisfactory as a complementary method in such a context.

Simultaneous determination of Cr, Fe, Ni and V in crude oil by emulsion sampling graphite furnace atomic absorption spectrometry

In this work a simple and reliable method for the simultaneous determination of Cr, Fe, Ni and V in crude oil, using emulsion sampling graphite furnace atomic absorption spectrometry is proposed. Under the best conditions, sample masses around 50 mg were weighed in polypropylene tubes and emulsified in a mixture of 0.5% (v v(-1)) hexane + 6% (m v(-1)) Triton X-100 (R). Considering the compromised conditions, the pyrolysis an atomization temperatures for the simultaneous determination of Cr, Fe, Ni and V were 1400 degrees C and 2500 degrees C, respectively. Aliquots of 20 mu L of reference solution and sample emulsion were co-injected into the graphite tube with 10 mu L of 1.0 g L(-1) Mg(NO(3))(2) as chemical modifier. The detection limits (n = 10, 3 sigma) and characteristic masses were, respectively: 0.07 mu g g(-1) and 19 pg for Cr; 2.15 mu g g(-1) and 31 pg for Fe; 1.25 mu g g(-1) and 44 pg for Ni; and 1.15 mu g g(-1) and 149 pg for V. The reliability of the proposed method was checked by fuel oil Standard Reference Material (SRMTriton X-100 (R) 1634c - NIST) analysis. The concentrations found presented no statistical differences compared to the certified values at 95% confidence level.

Simultaneous preconcentration of copper, zinc, cadmium, and nickel in water samples by cloud point extraction using 4-(2-pyridylazo)-resorcinol and their determination by inductively coupled plasma optic emission spectrometry

A procedure for simultaneous separation/preconcentration of copper. zinc, cadmium, and nickel in water samples, based on cloud point extraction (CPE) as a prior step to their determination by inductively coupled plasma optic emission spectrometry (ICP-OES), has been developed. The analytes reacted with 4-(2-pyridylazo)-resorcinol (PAR) at pH 5 to form hydrophobic chelates, which were separated and preconcentrated in a surfactant-rich phase of octylphenoxypolyethoxyethanol (Triton X-I 14). The parameters affecting the extraction efficiency of the proposed method, such as sample pH, complexing agent concentration, buffer amount, surfactant concentration, temperature, kinetics of complexation reaction, and incubation time were optimized and their respective values were 5, 0.6 mmol L(-1). 0.3 mL, 0.15% (w/v), 50 degrees C, 40 min, and 10 min for 15 mL of preconcentrated solution. The method presented precision (R.S.D.) between 1.3% and 2.6% (n = 9). The concentration factors with and without dilution of the surfactant-rich phase for the analytes ranged from 9.4 to 10.1 and from 94.0 to 100.1, respectively. The limits of detection (L.O.D.) obtained for copper, zinc, cadmium, and nickel were 1.2, 1.1, 1.0. and 6.3 mu g L(-1), respectively. The accuracy of the procedure was evaluated through recovery experiments on aqueous samples. (C) 2009 Published by Elsevier B.V.

Role of kinin B1 and B2 receptors in memory consolidation during the aging process of mice

Under physiological conditions, elderly people present memory deficit associated with neuronal loss. This pattern is also associated with Alzheimer`s disease but, in this case, in a dramatically intensified level. Kinin receptors have been involved in neurodegeneration and increase of amyloid-beta concentration, associated with Alzheimer`s disease (AD). Considering these findings, this work evaluated the role of kinin receptors in memory consolidation during the aging process. Male C57BI/6 (wt), knock-out B1 (koB1) or B2 (koB2) mice (3, 6, 12 and 18-month-old - mo; n = 10 per group) were submitted to an acquisition session, reinforcement to learning (24 h later: test 1) and final test (7 days later: test 2), in an active avoidance apparatus, to evaluate memory. Conditioned avoidance responses (CAR, % of 50 trials) were registered. In acquisition sessions, similar CAR were obtained among age matched animals from all strains. However, a significant decrease in CAR was observed throughout the aging process (3mo: 8.8 +/- 2.3%; 6mo: 4.1 +/- 0.6%; 12mo: 2.2 +/- 0.6%, 18mo: 3.6 +/- 0.6%, P < 0.01), indicating a reduction in the learning process. In test 1, as expected, memory retention increased significantly (P < 0.05) in all 3- and 6-month-old animals as well as in 12-month-old-wt and 12-month-old-koB1 (P < 0.01), compared to the training session. However, 12-month-old-koB2 and all 18-month-old animals did not show an increase in memory retention. In test 2, 3- and 6-month-old wt and koB1 mice of all ages showed a significant improvement in memory (P < 0.05) compared to test 1. However, 12-month-old wt and koB2 mice of all ages showed no difference in memory retention. We suggest that, during the aging process, the B1 receptor could be involved in neurodegeneration and memory loss. Nevertheless, the B2 receptor is apparently acting as a neuroprotective factor. (C) 2009 Elsevier Ltd. All rights reserved.

Monitoring stress tolerance and occurrences of upper respiratory illness in basketball players by means of psychometric tools and salivary biomarkers

The aim of the study was to evaluate the possible relationships between stress tolerance, training load, banal infections and salivary parameters during 4 weeks of regular training in fifteen basketball players. The Daily Analysis of Life Demands for Athletes` questionnaire (sources and symptoms of stress) and the Wisconsin Upper Respiratory Symptom Survey were used on a weekly basis. Salivary cortisol and salivary immunoglobulin A (SIgA) were collected at the beginning (before) and after the study, and measured by enzyme-linked immunosorbent assay (ELISA). Ratings of perceived exertion (training load) were also obtained. The results from ANOVA with repeated measures showed greater training loads, number of upper respiratory tract infection episodes and negative sensation to both symptoms and sources of stress, at week 2 (p < 0.05). Significant increases in cortisol levels and decreases in SIgA secretion rate were noted (before to after). Negative sensations to symptoms of stress at week 4 were inversely and significantly correlated with SIgA secretion rate. A positive and significant relationship between sources and symptoms of stress at week 4 and cortisol levels were verified. In summary, an approach incorporating in conjunction psychometric tools and salivary biomarkers could be an efficient means of monitoring reaction to stress in sport. Copyright (C) 2010 John Wiley & Sons, Ltd.