16 resultados para Developed applications

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Protocols for the generation of dendritic cells (DCs) using serum as a supplementation of culture media leads to reactions due to animal proteins and disease transmissions. Several types of serum-free media (SFM), based on good manufacture practices (GMP), have recently been used and seem to be a viable option. The aim of this study was to evaluate the results of the differentiation, maturation, and function of DCs from Acute Myeloid Leukemia patients (AML), generated in SFM and medium supplemented with autologous serum (AS). DCs were analyzed by phenotype characteristics, viability, and functionality. The results showed the possibility of generating viable DCs in all the conditions tested. In patients, the X-VIVO 15 medium was more efficient than the other media tested in the generation of DCs producing IL-12p70 (p=0.05). Moreover, the presence of AS led to a significant increase of IL-10 by DCs as compared with CellGro (p=0.05) and X-Vivo15 (p=0.05) media, both in patients and donors. We concluded that SFM was efficient in the production of DCs for immunotherapy in AML patients. However, the use of AS appears to interfere with the functional capacity of the generated DCs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to develop a questionnaire that evaluates the perception of nursing workers to job factors that may contribute to musculoskeletal symptoms, and to evaluate its psychometric properties. Internationally recommended methodology was followed: construction of domains, items and the instrument as a whole, content validity, and pre-test. Psychometric properties were evaluated among 370 nursing workers. Construct validity was analyzed by the factorial analysis, known-groups technique, and convergent validity. Reliability was assessed through internal consistency and stability. Results indicated satisfactory fit indices during confirmatory factor analysis, significant difference (p < 0.01) between the responses of nursing and office workers, and moderate correlations between the new questionnaire and Numeric Pain Scale, SF-36 and WRFQ. Cronbach's alpha was close to 0.90 and ICC values ranged from 0.64 to 0.76. Therefore, results indicated that the new questionnaire had good psychometric properties for use in studies involving nursing workers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prosopis rubriflora and Prosopis ruscifolia are important species in the Chaquenian regions of Brazil. Because of the restriction and frequency of their physiognomy, they are excellent models for conservation genetics studies. The use of microsatellite markers (Simple Sequence Repeats, SSRs) has become increasingly important in recent years and has proven to be a powerful tool for both ecological and molecular studies. In this study, we present the development and characterization of 10 new markers for P. rubriflora and 13 new markers for P. ruscifolia. The genotyping was performed using 40 P. rubriflora samples and 48 P. ruscifolia samples from the Chaquenian remnants in Brazil. The polymorphism information content (PIC) of the P. rubriflora markers ranged from 0.073 to 0.791, and no null alleles or deviation from Hardy-Weinberg equilibrium (HW) were detected. The PIC values for the P. ruscifolia markers ranged from 0.289 to 0.883, but a departure from HW and null alleles were detected for certain loci; however, this departure may have resulted from anthropic activities, such as the presence of livestock, which is very common in the remnant areas. In this study, we describe novel SSR polymorphic markers that may be helpful in future genetic studies of P. rubriflora and P. ruscifolia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• Microsatellite primers were developed for Orthophytum ophiuroides, a rupicolous bromeliad species endemic to neotropical rocky fields. These microsatellite loci will be used to investigate population differentiation and species cohesion in such fragmented environments. The loci were tested for cross-amplification in related bromeliad species. • Eleven polymorphic microsatellite markers were isolated and characterized from an enriched library of O. ophiuroides. The loci were tested on 42 individuals from two populations of this species. The number of alleles per locus ranged from three to nine and the expected and observed heterozygosities ranged from 0.167 to 0.870 and from 0.369 to 0.958, respectively. Seven loci successfully amplified in other related bromeliad species. • Our results suggest that the microsatellite loci developed here will be useful to assess genetic diversity and gene flow in O. ophiuroides for the investigation of population differentiation and species cohesion in neotropical mountainous habitats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Paper has become increasingly recognized as a very interesting substrate for the construction of microfluidic devices, with potential application in a variety of areas, including health diagnosis, environmental monitoring, immunoassays and food safety. The aim of this review is to present a short history of analytical systems constructed from paper, summarize the main advantages and disadvantages of fabrication techniques, exploit alternative methods of detection such as colorimetric, electrochemical, photoelectrochemical, chemiluminescence and electrochemiluminescence, as well as to take a closer look at the novel achievements in the field of bioanalysis published during the last 2 years. Finally, the future trends for production of such devices are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymeric nanoparticles have been developed for several applications, among them as carrier system of pesticides. However, few studies have investigated the fate of these materials in the environment in relation to colloidal stability and toxicity. In nature, humic substances are the main agents responsible for complexation with metals and organic compounds, as well as responsible for the dynamics of these nanoparticles in aquatic and terrestrial environments. In this context, the evaluation of the influence of aquatic humic substances (AHS) on the colloidal stability and toxicity of polymeric nanoparticles of chitosan/tripolyphosphate with or without paraquat was performed. In this study, the nanoparticles were prepared by the ionic gelation method and characterized by size distribution measurements (DLS and NTA), zeta potential, infrared and fluorescence spectroscopy. Allium cepa genotoxicity studies and ecotoxicity assays with the alga Pseudokirchneriella subcapitata were used to investigate the effect of aquatic humic substances (AHS) on the toxicity of this delivery system. No changes were observed in the physical-chemical stability of the nanoparticles due to the presence of AHS using DLS and NTA techniques. However some evidence of interaction between the nanoparticles and AHS was observed by infrared and fluorescence spectroscopies. The ecotoxicity and genotoxicity assays showed that humic substances can decrease the toxic effects of nanoparticles containing paraquat. These results are interesting because they are important for understanding the interaction of these nanostructured carrier systems with species present in aquatic ecosystems such as humic substances, and in this way, opening new perspectives for studies on the dynamics of these carrier systems in the ecosystem.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mapping of elements in biological tissue by laser induced mass spectrometry is a fast growing analytical methodology in life sciences. This method provides a multitude of useful information of metal, nonmetal, metalloid and isotopic distribution at major, minor and trace concentration ranges, usually with a lateral resolution of 12-160 µm. Selected applications in medical research require an improved lateral resolution of laser induced mass spectrometric technique at the low micrometre scale and below. The present work demonstrates the applicability of a recently developed analytical methodology - laser microdissection associated to inductively coupled plasma mass spectrometry (LMD ICP-MS) - to obtain elemental images of different solid biological samples at high lateral resolution. LMD ICP-MS images of mouse brain tissue samples stained with uranium and native are shown, and a direct comparison of LMD and laser ablation (LA) ICP-MS imaging methodologies, in terms of elemental quantification, is performed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since the last decade, the combined use of chemometrics and molecular spectroscopic techniques has become a new alternative for direct drug determination, without the need of physical separation. Among the new methodologies developed, the application of PARAFAC in the decomposition of spectrofluorimetric data should be highlighted. The first objective of this article is to describe the theoretical basis of PARAFAC. For this purpose, a discussion about the order of chemometric methods used in multivariate calibration and the development of multi-dimensional methods is presented first. The other objective of this article is to divulge for the Brazilian chemical community the potential of the combination PARAFAC/spectrofluorimetry for the determination of drugs in complex biological matrices. For this purpose, two applications aiming at determining, respectively, doxorrubicine and salicylate in human plasma are presented.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundamental aspects of the conception and applications of ecomaterials, in particular porous materials in the perspective of green chemistry are discussed in this paper. General recommendations for description and classification of porous materials are reviewed briefly. By way of illustration, some case studies of materials design and applications in pollution detection and remediation are described. It is shown here how different materials developed by our groups, such as porous glasses, ecomaterials from biomass and anionic clays were programmed to perform specific functions. A discussion of the present and future of ecomaterials in green chemistry is presented along with important key goals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física