919 resultados para fruit preserves
Resumo:
The elaboration of preserves through fruit processing is a promising alternative for their conservation. Such processing provides pleasant flavor due to the increase of sweetness and allows good conservation of the product for a prolonged time. Seeking quality and higher durability of fruit preserves, the purpose of this work was to evaluate the interference of potassium sorbate addition, and polypropylene, metallic and cellophane film packaging on the quality of guava (Psidium guajava L.) preserves during storage, through the physical, physiochemical and microbiological characteristics. The physical, physiochemical and microbiological analyses showed that the different types of packaging did not interfere in the stability of the guava preserves until the 5th month of storage - time being the factor that most influences the quality of the preserves when stored under temperature and humidity of 19.6 °C and 76.2%, respectively. The potassium sorbate caused an increase of the soluble solid levels and a decrease of the water activity. Regardless of the treatment, the preserves remained microbiologically stable during storage.
Resumo:
The industrialization of passion fruit in the form of juice produces considerable amounts of residue that could be used as food. The objective of the present study was to determine the effects of the volume of passion fruit juice added to the syrup and the cooking time on the color and texture of passion fruit albedo preserved in syrup. Multi-linear models were well fit to describe the value for a* (for the albedo) the values for b* (for the albedo and syrup), which exhibited high correlation coefficients of 98%, 84%, and 88%, respectively. The volume of passion fruit juice added and the cooking time of the albedos in the syrup, involved in the processing of passion fruit albedo preserves in syrup, significantly affected color analyses. The texture was not affected by the parameters studied. Therefore, the use of larger volumes of passion fruit juice and longer cooking time is recommended for the production of passion fruit albedo preserves in syrup to achieve the characteristic yellow color of the fruit.
Resumo:
The objective of this research was to evaluate the effect of the citric acid concentration, pulp/sugar ratio, and albedo concentration of the passion fruit peel on physical, physiochemical, and sensorial characteristics of the 'Silver' banana preserves. A 2³ factorial design and 3 repetitions in the central point were used. The albedo concentration between 0 and 3% had significant influence on the reduction of the reducing sugars and on the decrease in titratable acidity. The increase in the pulp/sugar ratio exerted a negative effect on the pH and positive on the titratable acidity; the acid addition reduced the non-reducing sugar level. The sensorial evaluation and purchase intention indicated that the incorporation of a maximum of 1.5% albedo in formulations containing 50% pulp and 0.5% citric acid resulted in products with good acceptability in comparison with the formulation in which 60% pulp and an absence of acid or albedo is utilized.
Resumo:
"Preface and apology" on p. [3] contains information on Mrs. Fisher's life and names of benefactors in San Francisco and Oakland who assisted her in writing the book.
Resumo:
Originally published under title: The compleat confectioner. Cf. Bitting, K.G. Gastronomic bib., p. 190.
Resumo:
The World Health Organization (WHO, 2005) recommends consumption of fruits and vegetables as part of a healthy diet with daily recommendation of 5 servings or at least 400 g per day. Fruits and vegetables are good sources of vitamins, minerals, antioxidants, and fiber. Papaya fruit is known for his high nutrient and fiber content, and with few exceptions, it is generally consumed ripe due to its characteristic flavor and aroma. Digestion improvement has been attributed to consumption of papaya; this we speculate is attributed to the fiber content and proteolytic enzymes associated with this highly nutritious fruit. However, research is lacking that evaluates the impact of papaya fruit on human digestion. Papain is a proteolytic enzyme generally extracted from the latex of unripe papaya. Previous research has focused on evaluating papain activity from the latex of different parts of the plant; however there are no reports about papain activity in papaya pulp through fruit maturation. The activity of papain through different stages of ripeness of papaya and its capacity of dislodging meat bolus in an in vitro model was addressed. The objective of this study was to investigate whether papain activity and fiber content are responsible for the digestive properties attributed to papaya and to find a processing method that preserves papaya health properties with minimal impact on flavor. Our results indicated that papain was active at all maturation stages of the fruit. Ripe papaya pulp displayed the highest enzyme activity and also presented the largest meat bolus displacement. The in vitro digestion study indicated that ripe papaya displayed the highest protein digestibility; this is associated with proteolytic enzymes still active at the acidity of the stomach. Results from the in vitro fermentation study indicated that ripe papaya produced the highest amount of Short Chain Fatty Acids SCFA of the three papaya substrates (unripe, ripe, and processed). SCFA are the most important product of fermentation and are used as indicators of the amount of substrate fermented by microorganisms in the colon. The combination of proteolytic enzymes and fiber content found in papaya make of this fruit not only a potential digestive aid, but also a good source of SCFA and their associated potential health benefits. Irradiation processing had minimal impact on flavor compounds of papaya nectar. However, processed papaya experienced the lowest protein digestibility and SCFA production among the papaya substrates. Future research needs to explore new processing methods for papaya that minimize the detrimental impact on enzyme activity and SCFA production.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.