Challenges of user-driven innovations on late stages of innovation process: evidence from ICT companies

The goal of this thesis is to study user-driven innovations and user involvement throughout the innovation process in context of B2B companies. Significant emphasis in the analysis put onto the late stages of innovation process and commercialization of innovations. Thesis includes detailed review of theoretical concepts and underlying frameworks of innovation process, lead users and user-driven innovations. The empirical part of the thesis consist of interviews of the four companies from ICT industry, followed by the comprehensive analysis and comparison of the results. The presented findings indicate common challenges, which ICT companies face, when shifting towards innovation by users paradigm. Linkages and connections among current situation and theoretical frameworks presented in the discussion part of the thesis allow to draw practical managerial implications. The results of the research emphasize valuable insights and challenges of user interactions within innovation process as well as output and participation related benefits for the companies and users. The research points out current state of the user involvement techniques and tools used for user interactions as well as suggests the possibilities for improvement in the future.

Mobile Communication Technology as a Tool of Educational Process

The article describes the application of mobile communication technology for enhancing of educational process.

Matching stages of heavy-ion collision models

Heavy-ion reactions and other collective dynamical processes are frequently described by different theoretical approaches for the different stages of the process, like initial equilibration stage, intermediate locally equilibrated fluid dynamical stage, and final freeze-out stage. For the last stage, the best known is the Cooper-Frye description used to generate the phase space distribution of emitted, noninteracting particles from a fluid dynamical expansion or explosion, assuming a final ideal gas distribution, or (less frequently) an out-of-equilibrium distribution. In this work we do not want to replace the Cooper-Frye description, but rather clarify the ways of using it and how to choose the parameters of the distribution and, eventually, how to choose the form of the phase space distribution used in the Cooper-Frye formula. Moreover, the Cooper-Frye formula is used in connection with the freeze-out problem, while the discussion of transition between different stages of the collision is applicable to other transitions also. More recently, hadronization and molecular dynamics models have been matched to the end of a fluid dynamical stage to describe hadronization and freeze-out. The stages of the model description can be matched to each other on space-time hypersurfaces (just like through the frequently used freeze-out hypersurface). This work presents a generalized description of how to match the stages of the description of a reaction to each other, extending the methodology used at freeze-out, in simple covariant form which is easily applicable in its simplest version for most applications.

Relatório de estágio

Mestrado em Educação Pré-Escolar e Ensino do 1.º Ciclo do Ensino Básico

Working together? Parent and local authority views on the process of obtaining appropriate educational provision for children with autism spectrum disorders

Background: There is general agreement across all interested parties that a process of working together is the best way to determine which school or educational setting is right for an individual child with autism spectrum disorder. In the UK, families and local authorities both desire a constructive working relationship and see this as the best means by which to reach an agreement to determine where a child should be educated. It has been shown in published works 1 1. Batten and colleagues (Make schools make sense. Autism and education: the reality for families today; London: The National Autistic Society, 2006). View all notes that a constructive working relationship is not always achieved. Purpose: This small-scale study aims to explore the views of both parents and local authorities, focussing on how both parties perceive and experience the process of determining educational provision for children with autism spectrum disorders (ASD) within an English context. Sample, design and method: Parental opinion was gathered through the use of a questionnaire with closed and open responses. The questionnaire was distributed to two national charities, two local charities and 16 specialist schools, which offered the questionnaire to parents of children with ASD, resulting in an opportunity sample of 738 returned surveys. The views of local authority personnel from five local authorities were gathered through the use of semi-structured interviews. Data analyses included quantitative analysis of the closed response questionnaire items, and theme-based qualitative analysis of the open responses and interviews with local authority personnel. Results: In the majority of cases, parents in the survey obtained their first choice placement for their child. Despite this positive outcome, survey data indicated that parents found the process bureaucratic, stressful and time consuming. Parents tended to perceive alternative placement suggestions as financially motivated rather than in the best interests of the child. Interviews with local authority personnel showed an awareness of these concerns and the complex considerations involved in determining what is best for an individual child. Conclusions: This small-scale study highlights the need for more effective communication between parents of children with ASDs and local authority personnel at all stages of the process

Welding time models for cost calculations in the early stages of the design process

It is generally accepted that between 70 and 80% of manufacturing costs can be attributed to design. Nevertheless, it is difficult for the designer to estimate manufacturing costs accurately, especially when alternative constructions are compared at the conceptual design phase, because of the lack of cost information and appropriate tools. In general, previous reports concerning optimisation of a welded structure have used the mass of the product as the basis for the cost comparison. However, it can easily be shown using a simple example that the use of product mass as the sole manufacturing cost estimator is unsatisfactory. This study describes a method of formulating welding time models for cost calculation, and presents the results of the models for particular sections, based on typical costs in Finland. This was achieved by collecting information concerning welded products from different companies. The data included 71 different welded assemblies taken from the mechanical engineering and construction industries. The welded assemblies contained in total 1 589 welded parts, 4 257 separate welds, and a total welded length of 3 188 metres. The data were modelled for statistical calculations, and models of welding time were derived by using linear regression analysis. Themodels were tested by using appropriate statistical methods, and were found to be accurate. General welding time models have been developed, valid for welding in Finland, as well as specific, more accurate models for particular companies. The models are presented in such a form that they can be used easily by a designer, enabling the cost calculation to be automated.

Critical stages of the brewing process for changes in antioxidant activity and levels of phenolic compounds in ale

Samples were taken at each stage of brewing (malt, milling, mashing, wort separation, hop addition, boiling, whirlpool, dilution, fermentation, warm rest, chill-lagering, beer filtration, carbonation and bottling, pasteurization, and storage). The level of antioxidant activity of unfractionated, low-molecular-mass (LMM) and high-molecular-mass (HMM) fractions was measured by the 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfortic acid) radical cation (ABTS(.+)) and ferric-reducing antioxidant power (FRAP) procedures. Polyphenol levels were assessed by HPLC. The LMM fraction (<5 kDa) was responsible for similar to80% of the level of antioxidant activity of the unfractionated malt and beer samples. In the unfractionated samples, significant decreases (P < 0.001) in antioxidant activity levels were observed after milling and beer filtration, with the decrease after beer filtration being accompanied by a significant decrease (P > 0.001) in catechin and ferulic acid levels. Increases in antioxidant activity levels were observed after mashing, boiling, fermentation, chill-lagering, and pasteurization, in line with previous studies on lager. Additionally, increases in the level of antioxidant activity occurred after wort separation and carbonation and bottling and were accompanied by increases in levels of most monitored polyphenols. Data from the ABTS(.-) and FRAP assays indicated that the compounds contributing to the levels of antioxidant activity responded differently in the two procedures. Levels of ferulic, vanillic, and chlorogenic acids and catechin accounted for 45-61% of the variation in antioxidant activity levels.

Understanding the early stages of the innovation diffusion process: awareness, influence and communication networks

The themes of awareness and influence within the innovation diffusion process are addressed. The innovation diffusion process is typically represented as stages, yet awareness and influence are somewhat under-represented in the literature. Awareness and influence are situated within the contextual setting of individual actors but also within the broader institutional forces. Understanding how actors become aware of an innovation and then how their opinion is influenced is important for creating a more innovation-active UK construction sector. Social network analysis is proposed as one technique for mapping how awareness and influence occur and what they look like as a network. Empirical data are gathered using two modes of enquiry. This is done through a pilot study consisting of chartered professionals and then through a case study organization as it attempted to diffuse an innovation. The analysis demonstrates significant variations across actors’ awareness and influence networks. It is argued that social network analysis can complement other research methods in order to present a richer picture of how actors become aware of innovations and where they draw their influences regarding adopting innovations. In summarizing the findings, a framework for understanding awareness and influence associated with innovation within the UK construction sector is presented. Finally, with the UK construction sector continually being encouraged to be innovative, understanding and managing an actor’s awareness and influence network will be beneficial. The overarching conclusion thus describes the need not only to build research capacity in this area but also to push the boundaries related to the research methods employed.

Management of social networks in the educational process

The research developed in this work consists in proposing a set of techniques for management of social networks and their integration into the educational process. The proposals made are based on assumptions that have been proven with simple examples in a real scenario of university teaching. The results show that social networks have more capacity to spread information than educational web platforms. Moreover, educational social networks are developed in a context of freedom of expression intrinsically linked to Internet freedom. In that context, users can write opinions or comments which are not liked by the staff of schools. However, this feature can be exploited to enrich the educational process and improve the quality of their achievement. The network has covered needs and created new ones. So, the figure of the Community Manager is proposed as agent in educational context for monitoring network and aims to channel the opinions and to provide a rapid response to an academic problem.

The Experience of Development and Application Perspectives of Learning Integrated Expert Systems in the Educational Process

The main principles and experience of development of learning integrated expert systems based on the third generation instrumental complex AT-TECHNOLOGY are considered.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física