Solution structure of the human signaling protein RACK1

Background: The adaptor protein RACK1 (receptor of activated kinase 1) was originally identified as an anchoring protein for protein kinase C. RACK1 is a 36 kDa protein, and is composed of seven WD repeats which mediate its protein-protein interactions. RACK1 is ubiquitously expressed and has been implicated in diverse cellular processes involving: protein translation regulation, neuropathological processes, cellular stress, and tissue development. Results: In this study we performed a biophysical analysis of human RACK1 with the aim of obtaining low resolution structural information. Small angle X-ray scattering (SAXS) experiments demonstrated that human RACK1 is globular and monomeric in solution and its low resolution structure is strikingly similar to that of an homology model previously calculated by us and to the crystallographic structure of RACK1 isoform A from Arabidopsis thaliana. Both sedimentation velocity and sedimentation equilibrium analytical ultracentrifugation techniques showed that RACK1 is predominantly a monomer of around 37 kDa in solution, but also presents small amounts of oligomeric species. Moreover, hydrodynamic data suggested that RACK1 has a slightly asymmetric shape. The interaction of RACK1 and Ki1/57 was tested by sedimentation equilibrium. The results suggested that the association between RACK1 and Ki-1/57(122-413) follows a stoichiometry of 1:1. The binding constant (KB) observed for RACK1-Ki-1/57(122-413) interaction was of around (1.5 +/- 0.2) x 10(6) M(-1) and resulted in a dissociation constant (KD) of (0.7 +/- 0.1) x 10(-6) M. Moreover, the fluorescence data also suggests that the interaction may occur in a cooperative fashion. Conclusion: Our SAXS and analytical ultracentrifugation experiments indicated that RACK1 is predominantly a monomer in solution. RACK1 and Ki-1/57(122-413) interact strongly under the tested conditions.

Low-Resolution Molecular Models Reveal the Oligomeric State of the PPAR and the Conformational Organization of Its Domains in Solution

The peroxisome proliferator-activated receptors (PPARs) regulate genes involved in lipid and carbohydrate metabolism, and are targets of drugs approved for human use. Whereas the crystallographic structure of the complex of full length PPAR gamma and RXR alpha is known, structural alterations induced by heterodimer formation and DNA contacts are not well understood. Herein, we report a small-angle X-ray scattering analysis of the oligomeric state of hPPAR gamma alone and in the presence of retinoid X receptor (RXR). The results reveal that, in contrast with other studied nuclear receptors, which predominantly form dimers in solution, hPPAR gamma remains in the monomeric form by itself but forms heterodimers with hRXR alpha. The low-resolution models of hPPAR gamma/RXR alpha complexes predict significant changes in opening angle between heterodimerization partners (LBD) and extended and asymmetric shape of the dimer (LBD-DBD) as compared with X-ray structure of the full-length receptor bound to DNA. These differences between our SAXS models and the high-resolution crystallographic structure might suggest that there are different conformations of functional heterodimer complex in solution. Accordingly, hydrogen/deuterium exchange experiments reveal that the heterodimer binding to DNA promotes more compact and less solvent-accessible conformation of the receptor complex.

Macromolecular assembly of polycystin-2 intracytosolic C-terminal domain

Mutations in PKD2 are responsible for approximately 15% of the autosomal dominant polycystic kidney disease cases. This gene encodes polycystin-2, a calcium-permeable cation channel whose C-terminal intracytosolic tail (PC2t) plays an important role in its interaction with a number of different proteins. In the present study, we have comprehensively evaluated the macromolecular assembly of PC2t homooligomer using a series of biophysical and biochemical analyses. Our studies, based on a new delimitation of PC2t, have revealed that it is capable of assembling as a homotetramer independently of any other portion of the molecule. Our data support this tetrameric arrangement in the presence and absence of calcium. Molecular dynamics simulations performed with a modified all-atoms structure-based model supported the PC2t tetrameric assembly, as well as how different populations are disposed in solution. The simulations demonstrated, indeed, that the best-scored structures are the ones compatible with a fourfold oligomeric state. These findings clarify the structural properties of PC2t domain and strongly support a homotetramer assembly of PC2.

Camptosemin, a tetrameric lectin of Camptosema ellipticum: structural and functional analysis

Lectins have been classified into a structurally diverse group of proteins that bind carbohydrates and glycoconjugates with high specificity. They are extremely useful molecules in the characterization of saccharides, as drug delivery mediators, and even as cellular surface makers. In this study, we present camptosemin, a new lectin from Camptosema ellipticum. It was characterized as an N-acetyl-d-galactosamine-binding homo-tetrameric lectin, with a molecular weight around 26 kDa/monomers. The monomers were stable over a wide range of pH values and exhibited pH-dependent oligomerization. Camptosemin promoted adhesion of breast cancer cells and hemagglutination, and both activities were inhibited by its binding of sugar. The stability and unfolding/folding behavior of this lectin was characterized using fluorescence and far-UV circular dichroism spectroscopies. The results indicate that chemical unfolding of camptosemin proceeds as a two-state monomer-tetramer process. In addition, small-angle X-ray scattering shows that camptosemin behaves as a soluble and stable homo-tetramer molecule in solution.

Structure of the haptoglobin-haemoglobin complex

Red cell haemoglobin is the fundamental oxygen-transporting molecule in blood, but also a potentially tissue-damaging compound owing to its highly reactive haem groups. During intravascular haemolysis, such as in malaria and haemoglobinopathies(1), haemoglobin is released into the plasma, where it is captured by the protective acute-phase protein haptoglobin. This leads to formation of the haptoglobin-haemoglobin complex, which represents a virtually irreversible non-covalent protein-protein interaction(2). Here we present the crystal structure of the dimeric porcine haptoglobin-haemoglobin complex determined at 2.9 angstrom resolution. This structure reveals that haptoglobin molecules dimerize through an unexpected beta-strand swap between two complement control protein (CCP) domains, defining a new fusion CCP domain structure. The haptoglobin serine protease domain forms extensive interactions with both the alpha- and beta-subunits of haemoglobin, explaining the tight binding between haptoglobin and haemoglobin. The haemoglobin-interacting region in the alpha beta dimer is highly overlapping with the interface between the two alpha beta dimers that constitute the native haemoglobin tetramer. Several haemoglobin residues prone to oxidative modification after exposure to haem-induced reactive oxygen species are buried in the haptoglobin-haemoglobin interface, thus showing a direct protective role of haptoglobin. The haptoglobin loop previously shown to be essential for binding of haptoglobin-haemoglobin to the macrophage scavenger receptor CD163 (ref. 3) protrudes from the surface of the distal end of the complex, adjacent to the associated haemoglobin alpha-subunit. Small-angle X-ray scattering measurements of human haptoglobin-haemoglobin bound to the ligand-binding fragment of CD163 confirm receptor binding in this area, and show that the rigid dimeric complex can bind two receptors. Such receptor cross-linkage may facilitate scavenging and explain the increased functional affinity of multimeric haptoglobin-haemoglobin for CD163 (ref. 4).

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Molecular adaptability of nucleoside diphosphate kinase b from trypanosomatid parasites: stability, oligomerization and structural determinants of nucleotide binding

Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.

Characterisation of amorphous and nanocrystalline molecular materials by total scattering

The use of high-energy X-ray total scattering coupled with pair distribution function analysis produces unique structural fingerprints from amorphous and nanostructured phases of the pharmaceuticals carbamazepine and indomethacin. The advantages of such facility-based experiments over laboratory-based ones are discussed and the technique is illustrated with the characterisation of a melt-quenched sample of carbamazepine as a nanocrystalline (4.5 nm domain diameter) version of form III.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Mode of operation and low-resolution structure of a multi-domain and hyperthermophilic endo-beta-1,3-glucanase from Thermotoga petrophila

1,3-beta-Glucan depolymerizing enzymes have considerable biotechnological applications including biofuel production, feedstock-chemicals and pharmaceuticals. Here we describe a comprehensive functional characterization and low-resolution structure of a hyperthermophilic laminarinase from Thermotoga petrophila (TpLam). We determine TpLam enzymatic mode of operation, which specifically cleaves internal beta-1,3-glucosidic bonds. The enzyme most frequently attacks the bond between the 3rd and 4th residue from the non-reducing end, producing glucose, laminaribiose and laminaritriose as major products. Far-UV circular dichroism demonstrates that TpLam is formed mainly by beta structural elements, and the secondary structure is maintained after incubation at 90 degrees C. The structure resolved by small angle X-ray scattering, reveals a multi-domain structural architecture of a V-shape envelope with a catalytic domain flanked by two carbohydrate-binding modules. Crown Copyright (C) 2011 Published by Elsevier Inc. All rights reserved.

Correlation of reactivity with structural factors in a series of Fe(II) substituted cobalt ferrites

A series of powdered cobalt ferrites, CoxFe3-xO4 with 0.66 <= x< 1.00 containing different amounts of Fe-II, were synthesized by a mild procedure, and their Fe and Co site occupancies and structural characteristics were explored using X-ray anomalous scattering and the Rietveld refinement method. The dissolution kinetics, measured in 0.1 M oxalic acid aqueous solution at 70 degrees C, indicate in all cases the operation of a contracting volume rate law. The specific rates increased with the Fell content following approximately a second-order polynomial expression. This result suggests that the transfer of Fe-III controls the dissolution rate, and that the leaching of a first layer of ions Co-II and Fe-II leaves exposed a surface enriched in slower dissolving octahedral Fe-III ions. Within this model, inner vicinal lattice Fe-II accelerates the rate of Fe-III transfer via internal electron hopping. A chain mechanism, involving successive electron transfers, fits the data very well. (C) 2006 Elsevier B.V. All rights reserved.

Electromagnetic simulation and measurement of diffuse scattering from building walls

Il fenomeno dello scattering diffuso è stato oggetto di numerosi studi nell’arco degli ultimi anni, questo grazie alla sua rilevanza nell’ambito della propagazione elettromagnetica così come in molti altri campi di applicazione (remote sensing, ottica, fisica, etc.), ma la compresione completa di questo effetto è lungi dall’essere raggiunta. Infatti la complessità nello studio e nella caratterizzazione della diffusione deriva dalla miriade di casistiche ed effetti che si possono incontrare in un ambiente di propagazione reale, lasciando intuire la necessità di trattarne probabilisticamente il relativo contributo. Da qui nasce l’esigenza di avere applicazioni efficienti dal punto di vista ingegneristico che coniughino la definizione rigorosa del fenomeno e la conseguente semplificazione per fini pratici. In tale visione possiamo descrivere lo scattering diffuso come la sovrapposizione di tutti quegli effetti che si scostano dalle classiche leggi dell’ottica geometrica (riflessione, rifrazione e diffrazione) che generano contributi del campo anche in punti dello spazio e direzioni in cui teoricamente, per oggetti lisci ed omogenei, non dovrebbe esserci alcun apporto. Dunque l’effetto principale, nel caso di ambiente di propagazione reale, è la diversa distribuzione spaziale del campo rispetto al caso teorico di superficie liscia ed omogenea in congiunzione ad effetti di depolarizzazione e redistribuzione di energia nel bilancio di potenza. Perciò la complessità del fenomeno è evidente e l’obiettivo di tale elaborato è di proporre nuovi risultati che permettano di meglio descrivere lo scattering diffuso ed individuare altresì le tematiche sulle quali concentrare l’attenzione nei lavori futuri. In principio è stato quindi effettuato uno studio bibliografico così da identificare i modelli e le teorie esistenti individuando i punti sui quali riflettere maggiormente; nel contempo si sono analizzate le metodologie di caratterizzazione della permittività elettrica complessa dei materiali, questo per valutare la possibilità di ricavare i parametri da utilizzare nelle simulazioni utilizzando il medesimo setup di misura ideato per lo studio della diffusione. Successivamente si è realizzato un setup di simulazione grazie ad un software di calcolo elettromagnetico (basato sul metodo delle differenze finite nel dominio del tempo) grazie al quale è stato possibile analizzare la dispersione tridimensionale dovuta alle irregolarità del materiale. Infine è stata condotta una campagna di misure in camera anecoica con un banco sperimentale realizzato ad-hoc per effettuare una caratterizzazione del fenomeno di scattering in banda larga.