973 resultados para RAY SOLUTION SCATTERING
Resumo:
Water-ethanol mixtures are commonly used in industry and house holds. However, quite surprisingly their molecular-level structure is still not completely understood. In particular, there is evidence that the local intermolecular geometries depend significantly on the concentration. The aim of this study was to gain information on the molecular-level structures of water-ethanol mixtures by two computational methods. The methods are classical molecular dynamics (MD), where the movement of molecules can be studied, and x-ray Compton scattering, in which the scattering cross section is sensitive to the electron momentum density. Firstly, the water-ethanol mixtures were studied with MD simulations, with the mixture concentration ranging from 0 to 100%. For the simulations well-established force fields were used for the water and ethanol molecules (TIP4P and OPLS-AA, respectively). Moreover, two models were used for ethanol, rigid and non-rigid. In the rigid model the intramolecular bond lengths are fixed, whereas in the non-rigid model the lengths are determined by harmonic potentials. Secondly, mixtures with three different concentrations employing both ethanol models were studied by calculating the experimentally observable x-ray quantity, the Compton profile. In the MD simulations a slight underestimation in the density was observed as compared to experiment. Furthermore, a positive excess of hydrogen bonding with water molecules and a negative one with ethanol was quantified. Also, the mixture was found more structured when the ethanol concentration was higher. Negligible differences in the results were found between the two ethanol models. In contrast, in the Compton scattering results a notable difference between the ethanol models was observed. For the rigid model the Compton profiles were similar for all the concentrations, but for the non-rigid model they were distinct. This leads to two possibilities of how the mixing occurs. Either the mixing is similar in all concentrations (as suggested by the rigid model) or the mixing changes for different concentrations (as suggested by the non-rigid model). Either way, this study shows that the choice of the force field is essential in the microscopic structure formation in the MD simulations. When the sources of uncertainty in the calculated Compton profiles were analyzed, it was found that more statistics needs to be collected to reduce the statistical uncertainty in the final results. The obtained Compton scattering results can be considered somewhat preliminary, but clearly indicative of the behaviour of the water-ethanol mixtures when the force field is modified. The next step is to collect more statistics and compare the results with experimental data to decide which ethanol model describes the mixture better. This way, valuable information on the microscopic structure of water-ethanol mixtures can be found. In addition, information on the force fields in the MD simulations and on the ability of the MD simulations to reproduce the microscopic structure of binary liquids is obtained.
Resumo:
Spectroscopy can provide valuable information on the structure of disordered matter beyond that which is available through e.g. x-ray and neutron diffraction. X-ray Raman scattering is a non-resonant element-sensitive process which allows bulk-sensitive measurements of core-excited spectra from light-element samples. In this thesis, x-ray Raman scattering is used to study the local structure of hydrogen-bonded liquids and solids, including liquid water, a series of linear and branched alcohols, and high-pressure ice phases. Connecting the spectral features to the local atomic-scale structure involves theoretical references, and in the case of hydrogen-bonded systems the interpretation of the spectra is currently actively debated. The systematic studies of the intra- and intermolecular effects in alcohols, non-hydrogen-bonded neighbors in high-pressure ices, and the effect of temperature in liquid water are used to demonstrate different aspects of the local structure that can influence the near-edge spectra. Additionally, the determination of the extended x-ray absorption fine structure is addressed in a momentum-transfer dependent study. This work demonstrates the potential of x-ray Raman scattering for unique studies of the local structure of a variety of disordered light-element systems.
Resumo:
Variations of peak position of the rocking curve in the Bragg case are measured from a Ge thin crystal near the K-absorption edge. The variations are caused by a phase change of the real part of the atomic scattering factor. Based on the measurement, the values of the real part are determined with an accuracy of better than 1%. The values are the most reliable ones among those reported values so far as they are directly determined from the normal atomic scattering factors.
Resumo:
High-resolution X-ray diffraction has been employed to investigate the diffuse scattering in a (0001) oriented GaN epitaxial film grown on sapphire substrate. The analysis reveals that defect clusters are present in GaN films and their concentration increases as the density of threading dislocations increases. Meanwhile, the mean radius of these defect clusters shows a reverse tendency. This result is explained by the effect of clusters preferentially forming around dislocations, which act as effective sinks for the segregation of point defects. The electric mobility is found to decrease as the cluster concentration increases.
Resumo:
The peroxisome proliferator-activated receptors (PPARs) regulate genes involved in lipid and carbohydrate metabolism, and are targets of drugs approved for human use. Whereas the crystallographic structure of the complex of full length PPAR gamma and RXR alpha is known, structural alterations induced by heterodimer formation and DNA contacts are not well understood. Herein, we report a small-angle X-ray scattering analysis of the oligomeric state of hPPAR gamma alone and in the presence of retinoid X receptor (RXR). The results reveal that, in contrast with other studied nuclear receptors, which predominantly form dimers in solution, hPPAR gamma remains in the monomeric form by itself but forms heterodimers with hRXR alpha. The low-resolution models of hPPAR gamma/RXR alpha complexes predict significant changes in opening angle between heterodimerization partners (LBD) and extended and asymmetric shape of the dimer (LBD-DBD) as compared with X-ray structure of the full-length receptor bound to DNA. These differences between our SAXS models and the high-resolution crystallographic structure might suggest that there are different conformations of functional heterodimer complex in solution. Accordingly, hydrogen/deuterium exchange experiments reveal that the heterodimer binding to DNA promotes more compact and less solvent-accessible conformation of the receptor complex.
Resumo:
Lectins have been classified into a structurally diverse group of proteins that bind carbohydrates and glycoconjugates with high specificity. They are extremely useful molecules in the characterization of saccharides, as drug delivery mediators, and even as cellular surface makers. In this study, we present camptosemin, a new lectin from Camptosema ellipticum. It was characterized as an N-acetyl-d-galactosamine-binding homo-tetrameric lectin, with a molecular weight around 26 kDa/monomers. The monomers were stable over a wide range of pH values and exhibited pH-dependent oligomerization. Camptosemin promoted adhesion of breast cancer cells and hemagglutination, and both activities were inhibited by its binding of sugar. The stability and unfolding/folding behavior of this lectin was characterized using fluorescence and far-UV circular dichroism spectroscopies. The results indicate that chemical unfolding of camptosemin proceeds as a two-state monomer-tetramer process. In addition, small-angle X-ray scattering shows that camptosemin behaves as a soluble and stable homo-tetramer molecule in solution.
Resumo:
Red cell haemoglobin is the fundamental oxygen-transporting molecule in blood, but also a potentially tissue-damaging compound owing to its highly reactive haem groups. During intravascular haemolysis, such as in malaria and haemoglobinopathies(1), haemoglobin is released into the plasma, where it is captured by the protective acute-phase protein haptoglobin. This leads to formation of the haptoglobin-haemoglobin complex, which represents a virtually irreversible non-covalent protein-protein interaction(2). Here we present the crystal structure of the dimeric porcine haptoglobin-haemoglobin complex determined at 2.9 angstrom resolution. This structure reveals that haptoglobin molecules dimerize through an unexpected beta-strand swap between two complement control protein (CCP) domains, defining a new fusion CCP domain structure. The haptoglobin serine protease domain forms extensive interactions with both the alpha- and beta-subunits of haemoglobin, explaining the tight binding between haptoglobin and haemoglobin. The haemoglobin-interacting region in the alpha beta dimer is highly overlapping with the interface between the two alpha beta dimers that constitute the native haemoglobin tetramer. Several haemoglobin residues prone to oxidative modification after exposure to haem-induced reactive oxygen species are buried in the haptoglobin-haemoglobin interface, thus showing a direct protective role of haptoglobin. The haptoglobin loop previously shown to be essential for binding of haptoglobin-haemoglobin to the macrophage scavenger receptor CD163 (ref. 3) protrudes from the surface of the distal end of the complex, adjacent to the associated haemoglobin alpha-subunit. Small-angle X-ray scattering measurements of human haptoglobin-haemoglobin bound to the ligand-binding fragment of CD163 confirm receptor binding in this area, and show that the rigid dimeric complex can bind two receptors. Such receptor cross-linkage may facilitate scavenging and explain the increased functional affinity of multimeric haptoglobin-haemoglobin for CD163 (ref. 4).
Resumo:
Scattering of X-rays and neutrons has been applied to the study of nanostructures with interesting biological functions. The systems studied were the protein calmodulin and its complexes, bacterial virus bacteriophage phi6, and the photosynthetic antenna complex from green sulfur bacteria, chlorosome. Information gathered using various structure determination methods has been combined to the low resolution information obtained from solution scattering. Conformational changes in calmodulin-ligand complex were studied by combining the directional information obtained from residual dipole couplings in nuclear magnetic resonance to the size information obtained from small-angle X-ray scattering from solution. The locations of non-structural protein components in a model of bacteriophage phi6, based mainly on electron microscopy, were determined by neutron scattering, deuterium labeling and contrast variation. New data are presented on the structure of the photosynthetic antenna complex of green sulfur bacteria and filamentous anoxygenic phototrophs, also known as the chlorosome. The X-ray scattering and electron cryomicroscopy results from this system are interpreted in the context of a new structural model detailed in the third paper of this dissertation. The model is found to be consistent with the results obtained from various chlorosome containing bacteria. The effect of carotenoid synthesis on the chlorosome structure and self-assembly are studied by carotenoid extraction, biosynthesis inhibition and genetic manipulation of the enzymes involved in carotenoid biosynthesis. Carotenoid composition and content are found to have a marked effect on the structural parameters and morphology of chlorosomes.
Resumo:
We have resolved the solid-liquid phase transition of carbon at pressures around 150GPa. High-pressure samples of different temperatures were created by laser-driven shock compression of graphite and varying the initial density from 1.30g/cm3 to 2.25g/cm3. In this way, temperatures from 5700K to 14,500K could be achieved for relatively constant pressure according to hydrodynamic simulations. From measuring the elastic X-ray scattering intensity of vanadium K-alpha radiation at 4.95keVat a scattering angle of 126°, which is very sensitive to the solid-liquid transition, we can determine whether the sample had transitioned to the fluid phase. We find that samples of initial density 1.3g/cm3 and 1.85g/cm3 are liquid in the compressed states, whereas samples close to the ideal graphite crystal density of 2.25g/cm3 remain solid, probably in a diamond-like state.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Structural investigations, i.e. solid-state (X-ray), solution (1H NMR) and gas-phase (theoretical), on molecules with the general formula MeOC(S)N(H)C6H4-4-Y: Y = H (1), NO2 (2), C(O)Me (3), Cl (4) have shown a general preference for the adoption of an E-conformation about the central C–N bond. Such a conformation allows for the formation of a dimeric hydrogen-bonded {H–N–C=S}2 synthon as the building block. In the cases of 1–3, additional C–H...O interactions give rise to the formation of tapes of varying topology. A theoretical analysis shows that the preference for the E-conformation is about the same as the crystal packing stabilisation energy and consistent with this, the compound with Y = C(O)OMe, (5), adopts a Z-conformation in the solid-state that facilitates the formation of N–H...O, C–H...O and C–H...S interactions, leading to a layer structure. Global crystal packing considerations are shown to be imperative in dictating the conformational form of molecules 1–5.
Resumo:
X-ray Raman scattering and x-ray emission spectroscopies were used to study the electronic properties and phase transitions in several condensed matter systems. The experimental work, carried out at the European Synchrotron Radiation Facility, was complemented by theoretical calculations of the x-ray spectra and of the electronic structure. The electronic structure of MgB2 at the Fermi level is dominated by the boron σ and π bands. The high density of states provided by these bands is the key feature of the electronic structure contributing to the high critical temperature of superconductivity in MgB2. The electronic structure of MgB2 can be modified by atomic substitutions, which introduce extra electrons or holes into the bands. X ray Raman scattering was used to probe the interesting σ and π band hole states in pure and aluminum substituted MgB2. A method for determining the final state density of electron states from experimental x-ray Raman scattering spectra was examined and applied to the experimental data on both pure MgB2 and on Mg(0.83)Al(0.17)B2. The extracted final state density of electron states for the pure and aluminum substituted samples revealed clear substitution induced changes in the σ and π bands. The experimental work was supported by theoretical calculations of the electronic structure and x-ray Raman spectra. X-ray emission at the metal Kβ line was applied to the studies of pressure and temperature induced spin state transitions in transition metal oxides. The experimental studies were complemented by cluster multiplet calculations of the electronic structure and emission spectra. In LaCoO3 evidence for the appearance of an intermediate spin state was found and the presence of a pressure induced spin transition was confirmed. Pressure induced changes in the electronic structure of transition metal monoxides were studied experimentally and were analyzed using the cluster multiplet approach. The effects of hybridization, bandwidth and crystal field splitting in stabilizing the high pressure spin state were discussed. Emission spectroscopy at the Kβ line was also applied to FeCO3 and a pressure induced iron spin state transition was discovered.
Resumo:
This thesis presents a novel application of x-ray Compton scattering to structural studies of molecular liquids. Systematic Compton-scattering experiments on water have been carried out with unprecedented accuracy at third-generation synchrotron-radiation laboratories. The experiments focused on temperature effects in water, the water-to-ice phase transition, quantum isotope effects, and ion hydration. The experimental data is interpreted by comparison with both model computations and ab initio molecular-dynamics simulations. Accordingly, Compton scattering is found to provide unique intra- and intermolecular structural information. This thesis thus demonstrates the complementarity of the technique to traditional real-space probes for studies on the local structure of water and, more generally, molecular liquids.