918 resultados para Fruit shrinkage
Resumo:
This work project regards a challenge presented by a Portuguese organization on the retail sector, SONAEMC, which is a case study of how and why fruit shrinkage occurs in the fruit supply chain within their convenience stores. A qualitative research methodology enabled to infer in which stages throughout the chain shrinkage’s causes occur and, to conclude that internal rules for procedures and processes are not always followed and whose compliance would be enough to reduce fruit shrinkage. The key conclusion is that if fruit stock loss is reduced by as much as 15% the category’s profitability could increase about 8%.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Three particular geometrical shapes of parallelepiped, cylinder and sphere were selected from cut beans (length : diameter = 1: 1, 2:1, 3: 1), potatoes (aspect ratio = 1:1, 2:1, 3:1) and peas, respectively. The dimensional shrinkage behavior was studied in a batch fluidized bed at three drying temperatures of 30, 40 and 50C. Relative humidity of hot air was kept at 15%. Dimensional shrinkage was plotted using a nondimensional moisture ratio and the shrinkage behavior of the selected foods was modeled with simple mathematical models.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The purpose of this study was to compare the polymerization shrinkage stress of composite resins (microfilled, microhybrid and hybrid) photoactivated by quartz-tungsten halogen light (QTH) and light-emitting diode (LED). Glass rods (5.0 mm x 5.0 cm) were fabricated and had one of the surfaces air-abraded with aluminum oxide and coated with a layer of an adhesive system, which was photoactivated with the QTH unit. The glass rods were vertically assembled, in pairs, to a universal testing machine and the composites were applied to the lower rod. The upper rod was placed closer, at 2 mm, and an extensometer was attached to the rods. The 20 composites were polymerized by either QTH (n=10) or LED (n=10) curing units. Polymerization was carried out using 2 devices positioned in opposite sides, which were simultaneously activated for 40 s. Shrinkage stress was analyzed twice: shortly after polymerization (t40s) and 10 min later (t10min). Data were analyzed statistically by 2-way ANOVA and Tukey's test (a=5%). The shrinkage stress for all composites was higher at t10min than at t40s, regardless of the activation source. Microfilled composite resins showed lower shrinkage stress values compared to the other composite resins. For the hybrid and microhybrid composite resins, the light source had no influence on the shrinkage stress, except for microfilled composite at t10min. It may be concluded that the composition of composite resins is the factor with the strongest influence on shrinkage stress.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
The effects of thermal treatment on the wettability and shrink resistance of Araucaria angustifolia (Parana pine) were studied from 20 to 200 °C. The contact angles of water droplets on untreated and heat-treated samples were measured by the sessile drop method in the grain of heartwood and sapwood cut in the radial, longitudinal, and tangential directions. A significant increase of the contact angles was verified for the samples from room temperature to 120 °C, in particular in the radial and tangential directions; at higher temperatures, the contact angles assumed almost constant values. From 120 to 200 °C, the sapwood of Araucaria angustifolia showed better dimensional stability and lower thermal resistance when compared to the heartwood. Variations of color were also studied by using the CIELab system, which showed to be capable of accurately distinguishing samples treated at different temperatures.
Resumo:
Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.