Approaches toward (eta(2)-HX) (X = H, SiR (R = Me-3 or Me2Ph), CH3) sigma-complexes of ruthenium

Two new Ru(II)-complexes RuH(Tpms)(PPh3)(2)] 1 (Tpms - (C3H3N2)(3)CSO3, tris-(pyrazolyl) methane sulfonate) and Ru(OTf)(Tpms)(PPh3)(2)] 2 (OTf = CF3SO3) have been synthesized and characterized wherein Ru-H and Ru-OTf are the key reactive centers. Reaction of 1 with HOTf results in the Ru(eta(2)-H-2)(Tpms)(PPh3)(2)]OTf] complex 3, whereas reaction of 1 with Me3SiOTf affords the dihydrogen complex 3 and complex 1 through an unobserved sigma-silane intermediate. In addition, an attempt to characterize the sigma methane complex via reaction of complex 1 with CH3OTf yields complex 2 and free methane. On the other hand, reaction of Ru(OTf)(Tpms)(PPh3)(2)] 2 with H-2 and PhMe2SiH at low temperature resulted in sigma-H-2, 3 and a probable sigma-silane complexes, respectively. However, no sigma-methane complex was observed for the reaction of complex 2 with methane even at low temperature. (C) 2014 Elsevier B. V. All rights reserved.

Synthesis, characterization and reactivity studies of electrophilic ruthenium(II) complexes: a study of H-2 activation and labilization

Reaction of 2,2'-bipyridine (bpy) with dinuclear complexesRuCl(dfppe)(mu-Cl)(3)Ru(dmso-S)(3)](dfppe = 1,2-bis(dipentafluorophenyl phosphino)ethane (C6F5)(2)PCH2CH2P(C6F5)(2); dmso = dimethyl sulfoxide) (1) or RuCl(dfppe)(mu-Cl)(3)RuCl(dfppe)] (2) affords the mononuclear species trans-RuCl2(bpy)(dfppe)] (3). Using this precursor complex (3), a series of new cationic Ru(II) electrophilic complexes RuCl(L)(bpy)(dfppe)]Z] (L = P(OMe)(3) (5), PMe3 (6), CH3CN (7), CO (8), H2O (9); Z = OTf (5, 6, 7, 8), BAr4F (9) have been synthesized via abstraction of chloride by AgOTf or NaBAr4F in the presence of L. Complexes 5 and 6 were converted into the corresponding isomeric hydride derivatives RuH(PMe3)(bpy)(dfppe)]OTf] (10a, 10b) and RuH(P(OMe)(3))(bpy)(dfppe)]OTf] (11a, 11b) respectively, when treated with NaBH4. Protonation of the cationic monohydride complex (11a) with HOTf at low temperatures resulted in H-2 evolution accompanied by the formation of either solvent or triflate bound six coordinated species Ru(S)(P(OMe)(3))(bpy)(dfppe)]OTf](n) (S = solvent (n = 2), triflate (n = 1)] (13a/13b); these species have not been isolated and could not be established with certainty. They (13a/13b) were not isolated, instead the six-coordinated isomeric aqua complexes cis-(Ru(bpy)(dfppe)(OH2)(P(OMe)(3))]OTf](2) (14a/14b) were isolated. Reaction of the aqua complexes (14a/14b) with 1 atm of H-2 at room temperature in acetone-d(6) solvent resulted in heterolytic cleavage of the H-H bond. Results of the studies on H-2 lability and heterolytic activation using these complexes are discussed. The complexes 3, 5, 11a, and 14a have been structurally characterized.

Chemical and electrochemical investigations of cobalt cyanide and ruthenium ammine complexes

Part I.

The stoichiometry and kinetics of the reaction between Co(CN₅H^3- and HgX₂ (X = CN, OH) have been investigated. The products of the reaction are two new complexes, [(NC)₅Co-HgX]^3- and [(NC)₅Co-Hg-Co(CN)₅]^6-, whose spectra are reported. The kinetic measurements produced a value for the forward rate constant of the reaction Co(CN)₅H^3- + OH^- k₁/k_-1 Co(CN)₅^4- +H₂O, k1 = (9.7 ± 0.8) x 10^-2 M^-1 sec^-1 at 24°C, and an equilibrium constant for the reaction K = 10^-6 M^-1.

Part II.

Unusually large and sharp "adsorption waves" appear in cyclic voltammograms of Co(CN)₅^3- and several cobalt(III) pentacyano complexes at stationary mercury electrodes. The nature of the adsorbed species and the reasons for the absence of the adsorption waves in polarograms taken with a d.m.e. have been examined. The data are compatible with the adsorption, in all cases, of a coordinatively unsaturated cobalt(II) complex, Co(CN)₄^2-, by means of a cobalt-mercury bond. When the resulting adsorbed complex is reduced, a series of subsequent chemical and electrode reactions is initiated in which three faradays of charge are consumed for each mole of adsorbed complex. The adsorption of the anionic complex strongly retards the reduction of other negatively charged complexes.

Part III.

A number of formal redox potentials for Ru^III (NH₃)₅L + e = Ru^II (NH₃)₅L and Ru^III(NH₃)₄L₂ + e = Ru^II (NH₃)₄L₂ (where L is various ligands) has been measured by cyclic voltammetry, potentiometry, and polarography and are discussed in terms of the properties of the ligands, such as π-accepting capability. Reduction of coordinated pyrazine in the complexes, Ru(NH₃)₅ Pz²⁺, cis- and trans-Ru(NH₃)₄Pz₂²⁺, on a mercury electrode has been observed. The behavior of this reduction in various acidity of the solution as well as the reoxidation of the reduction products are discussed.

Oligoaniline-Functionalized terpyridine ligands and their ruthenium(II) complexes: synthesis, spectroscopic property and redox behaviors

A series of oligoaniline-functionalized mono- and bis-topic terpyridine ligands, i.e. C6H5[N(R)C6H4](n)TPY (R = H, butyl, tert-butyloxycarbonyl; n = 1-4; TPY = 2,2':6',2"-terpyridyl) and TPYC6H4[N(R)C6H4](m)TPY (R = H, tert-butyloxycarbonyl; m = 2, 4), and the corresponding monoand bis-nuclear ruthenium(II) complexes have been synthesized and verified. The spectroscopic results indicate that two kinds of pi-pi* transitions from TPY and oligoaniline fragments of ligands strongly shift to lower energy, and the metal-to-ligand charge-transfer transition ((MLCT)-M-1) bands of all obtained complexes are considerably red-shifted (Delta lambda(max) = 22-64 nm) and their intensities become much more intense (approximately 4-6 times), compared with those of the reported complex [Ru(TPY)(2)](2+). Moreover, the spectroscopic properties of the ligands and complexes with longer oligoaniline units (n = 3, 4) are markedly influenced by the external stimulus, such as the oxidation and proton acid doping.

Synthesis and characterization of ferrocene-terminated ruthenium phenylacetylide complexes with alligator clips

Ferrocene-terminated trans/Ru(dppm)(2) (dppm=Ph2PCH2PPh2)-contained molecular wires with alligator clips were prepared. They are suitable for self-assembly on gold electrode to investigate the influence of metal incorporation on the electron transportation property of the molecular wires.

The efficient syntheses of three novel bridging phenanthroline ligands and their binuclear ruthenium(II) complexes

Three bridging ligands (L) and their binuclear phenanthroline ruthenium(II) complexes {[Ru(1,10-phenanthroline)(2)](2)(L)}(PF6)(4) were synthesized and characterized by IR, H-1 NMR, and elemental analysis, where L are 1,8-adipoylamido-bis(1,10-phenanthroline-5-yl) (L-1), 1,11-azelaoylamidobis(1, 10-phenanthroline-5-yl) (L-2), and p-phthaloylamido-bis(1,10-phenanthroline-5-yl) (L-3).

Synthesis, 2D NMR, electrochemistry and luminescence of ruthenium(II) complexes with 2,2 '-bipyridine and 5-(omega-bromoalkylamido)-1,10-phenanthroline

The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.

Characterisation of bifunctional ruthenium(ii) complexes, potential DNA photo-probes. Presence of folded and unfolded conformers

Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.

The Unexpected Preference for the fac-Isomer with the Tris(5-ester-substituted-2,2′-bipyridine) Complexes of Ruthenium(II)

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

The isolation and secondary functionalisation of fac-tris2,2'-bipyridine complexes of ruthenium(II)

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

A modular approach to luminescent dinuclear ruthenium(II) and rhenium(I) complexes

A series of dinuclear (bipyridine)tricarbonylrhenium(I) and tris(bipyridine)ruthenium(II) complexes have been isolated and characterised, bridged by a flexible diamido ethylene glycol chain. A new stepwise synthetic pathway has been investigated to heterometallic complexes, with the rhenium(I) complexes exhibiting an unusual configuration and inequivalence of the metal centres potentially arising from a surprising hydrogen-bonding interaction between an Re–CO group and an amide proton in low-polarity solvents. This interaction appears to be broken by competing hydrogen-bonding species such as dihydrogen phosphate. This effect was not observed in the corresponding ruthenium(II) complexes, which showed very little interaction with anions. The photophysical characterisation shows that the inclusion of two ester/amide groups to the rhenium centre effectively quenches the fluorescence at room temperature. The ruthenium(II) complexes have considerably stronger fluorescence than the rhenium species, and are less affected by theinclusion of ester and amide groups to the 2,2'-bipyridine chelating group.