Metamorfose planar via métodos Level Set e Particle Level Set para a reconstrução de superfícies tridimensionais

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Gluttonous predators: how to estimate prey size when there are too many prey

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Apedunculata discoidea gen. n., sp. n. (Monogenea: Dactylogyridae) parasitic on Prochilodus lineatus (Valenciennes, 1837) (Characiformes: Prochilodontidae) from southeastern Brazil

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Metamorfose planar via métodos Level Set e Particle Level Set para a reconstrução de superfícies tridimensionais

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Six new cases confirm the clinical molecular profile of complete combined 17α-hydroxylase/ 17,20-lyase deficiency in Brazil

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Comparação preliminar entre ultrassonografia quantitativa de falanges e densitometria óssea na avaliação da massa óssea em adolescentes

OBJECTIVE: To evaluate the association between quantitative ultrasonography at hand phalanges (QUS) and dual energy X-ray absorptiometry (DXA), and between these methods with food intake and history of bone fractures. SUBJECTS AND METHODS:After two years of follow up of 270 schoolchildren, 10 of them, who showed bone mass below - 2 SD in QUS, were included in the present study. Laboratory results and DXA data were analyzed. RESULTS: Bone mass evaluated by DXA at L1-L4 ranged from -2.8 to -1.1 SDS, and whole body bone mass, from -2.9 to -1.2 SDS. Three children had history of non-pathological bone fractures. Dietary assessment showed low intake of calcium in 10 cases, of phosphorus in 6, and of vitamin D in 8 cases. There were no differences among the cases of bone mass below-2 SD in any of the three used methods. There was no association between history of bone fractures and food intake, and between these evaluations and bone mass. CONCLUSION: In this small group of schoolchildren there was an association between the methods QUS and DXA. However, there was no association between bone mass and the history of bone fractures, or calcium, phosphorus and vitamin D intake.

Aspectos médicos e sociais no atendimento oftalmológico de urgência

Purpose: A survey was carried out on one hundred patients of the Emergency Service of the Ophthalmology Department of the Hospital das Clinicas of the University of Campinas (UNICAMP), in order to analyze the personal characteristics and the barriers against getting resolving ophthalmologic assistance. Variables, were the following: sex, age, home town, average distance between the place of initial symptoms and first visit to the hospital, time spent between the first examination (if performed in any other service) and the examination performed at the Hospital das Clinicas of University of Campinas, diagnosis, veracity of emergency, need to refer patients previously seen in other services to our Service and possibility of assistance and treatment at a secondary level. Methods: The sample showed the following characteristics: distances between 20 and 100 kilometers covered by 50.0% of the patients to be seen at University of Campinas. 75.0% of those patients needed someone to stay with them and 67.0% came from other municipalities. The long distances covered meant additional expenses for the treatment of diseases which should be treated locally. Results: Among the patients referred to University of Campinas by ophthalmologists of other services, 87.5% could have their diseases treated at a secondary level of assistance and 66.7% of real emergencies and 60% of false emergencies took longer than 7 days to reach the emergency room of University of Campinas. This shows the poor infrastructure of secondary services regarding excellence of emergency care and education of patients. Conclusions: We recommend education of general physicians and ophthalmologists for emergency eye care and also the supply of both secondary and tertiary public services or medicare, strategically setup in the whole state of Sao Paulo.

Patient education in glaucoma: what do patients know about glaucoma?

PURPOSE: To evaluate the knowledge glaucoma patients have about their disease and its treatment. METHODS: One hundred and eighty-three patients were interviewed at the Glaucoma Service of Wills Eye Hospital (Philadelphia, USA, Group 1) and 100 at the Glaucoma Service of University of Campinas (Campinas, Brazil, Group 2). An informal, relaxed atmosphere was created by the interviewer before asking a list of 18 open-ended questions. RESULTS: In Group 1, 44% of the 183 patients did not have an acceptable idea about what glaucoma is, 30% did not know the purpose of the medications they were taking, 47% were not aware of what was an average intraocular pressure, and 45% did not understand why visual fields were examined. In Group 2, 54% gave unsatisfactory answers to the question What is glaucoma?, 54% did not know the purpose of the medications they were taking, 80% were not aware of what was an average intraocular pressure, and 94% did not understand why visual fields were examined (p<0.001). Linear regression analysis demonstrated that level of education was positively correlated to knowledge about glaucoma in both groups (r=0.65, p=0.001). CONCLUSION: This study showed that patients' knowledge about glaucoma varies greatly, and that in an urban, American setting, around one third of the patients have minimal understanding, whereas in an urban setting in Brazil around two thirds of patients were lacking basic information about glaucoma. Innovative and effective methods are needed to correct this situation.