940 resultados para X-RAY-SCATTERING
Resumo:
X-ray multiple diffraction experiments with synchrotron radiation were carried out on pure and doped nonlinear optical crystals: NH(4)H(2)PO(4) and KH(2)PO(4) doped with Ni and Mn, respectively. Variations in the intensity profiles were observed from pure to doped samples, and these variations correlated with shifts in the structure factor phases, also known as triplet phases. This result demonstrates the potential of X-ray phase measurements to study doping in this type of single crystal. Different methodologies for probing structural changes were developed. Dynamical diffraction simulations and curve fitting procedures were also necessary for accurate phase determination. Structural changes causing the observed phase shifts are discussed.
Resumo:
A method of using X-ray absorption spectroscopy together with resolved grazing-incidence geometry for depth profiling of atomic, electronic or chemical local structures in thin films is presented. The quantitative deconvolution of thickness-dependent spectral features is performed by fully considering both scattering and absorption formalisms. Surface oxidation and local structural depth profiles in nanometric FePt films are determined, exemplifying the application of the method.
Resumo:
Here we use magnetic resonant x-ray diffraction to study the magnetic order in a 1.5 mu m EuTe film grown on (111) BaF(2) by molecular-beam epitaxy. At Eu L(II) and L(III) absorption edges, a resonant enhancement of more than two orders was observed for the sigma ->pi(') diffracted intensity at half-order reciprocal-lattice points, consistent with the magnetic character of the scattering. We studied the evolution of the (1/21/21/2) magnetic reflection with temperature. When heating toward the Neel temperature (T(N)), the integrated intensity decreased monotonously and showed no hysteresis upon cooling again, indicating a second-order phase transition. A power-law fit to the magnetization versus temperature curve yielded T(N)=9.99(1) K and a critical exponent beta=0.36(1), which agrees with the renormalization theory results for three-dimensional Heisenberg magnets. The fits to the sublattice magnetization dependence with temperature, disregarding and considering fourth-order exchange interactions, evidenced the importance of the latter for a correct description of magnetism in EuTe. A value of 0.009 was found for the (2j(1)+j(2))/J(2) ratio between the Heisenberg J(2) and fourth-order j(1,2) exchange constants. The magnetization curve exhibited a round-shaped region just near T(N) accompanied by an increase in the magnetic peak width, which was attributed to critical scattering above T(N). The comparison of the intensity ratio between the (1/21/21/2) and the (1/21/21/2) magnetic reflections proved that the Eu(2+) spins align within the (111) planes, and the azimuthal dependence of the (1/21/21/2) magnetic peak is consistent with the model of equally populated S domains.
Resumo:
In this work we use resonant x-ray diffraction combined with polarization analysis of the diffracted beam to study the magnetic ordering in EuTe/PbTe multilayers. The presence of satellites at the (1/2 1/2 1/2) magnetic reflection of a 50 /repetition EuTe/PbTe superlattice demonstrated the existence of magnetic correlations among the alternated EuTe layers. The behavior of the satellites intensity as T increases toward the Neel temperature T(N) indicates that these correlations persist nearly up to T(N) and suggests the preferential decrease of the magnetic order parameter of external monolayers of each EuTe layer within the superlattice. (C) 2008 American Institute of Physics.
Resumo:
Chlorocatechol 1,2-dioxygenase from the Gram-negative bacterium Pseudomonas putida (Pp 1,2-CCD) is considered to be an important biotechnological tool owing to its ability to process a broad spectrum of organic pollutants. In the current work, the crystallization, crystallographic characterization and phasing of the recombinant Pp 1,2-CCD enzyme are described. Reddish-brown crystals were obtained in the presence of polyethylene glycol and magnesium acetate by utilizing the vapour-diffusion technique in sitting drops. Crystal dehydration was the key step in obtaining data sets, which were collected on the D03B-MX2 beamline at the CNPEM/MCT - LNLS using a MAR CCD detector. Pp 1,2-CCD crystals belonged to space group P6(1)22 and the crystallographic structure of Pp 1,2-CCD has been solved by the MR-SAD technique using Fe atoms as scattering centres and the coordinates of 3-chlorocatechol 1,2-dioxygenase from Rhodococcus opacus (PDB entry
Resumo:
The goal of this work was to study the liquid crystalline structure of a nanodispersion delivery system intended to be used in photodynamic therapy after loading with photosensitizers (PSs) and additives such as preservatives and thickening polymers. Polarized light microscopy and light scattering were performed on a standard nanodispersion in order to determine the anisotropy of the liquid crystalline structure and the mean diameter of the nanoparticles, respectively. Small angle X-ray diffraction (SAXRD) was used to verify the influence of drug loading and additives on the liquid crystalline structure of the nanodispersions. The samples, before and after the addition of PSs and additives, were stable over 90 days, as verified by dynamic light scattering. SAXRD revealed that despite the alteration observed in some of the samples analyzed in the presence of photosensitizing drugs and additives, the hexagonal phase still remained in the crystalline phase. (C) 2011 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 100: 2849-2857, 2011
Resumo:
A method is presented for determining the composition of thin films containing the elements Bi, Sr, Br, Cu, and Ca. Quantitative x-ray fluorescence (XRF) consisting of radioactive sources (secondary foil excitor 241Am-Mo source and 55Pe source), a Si(Li) detector, and a multichannel analyzer were employed. The XRF system was calibrated by using sol gel thin films of known element composition and also by sputtered thin films analyzed by the conventional Rutherford Back Scattering (RBS). The XRF system has been used to assist and optimize the sputter target composition required to produce high-Tc BiSrCaCuO films with the desired metal composition.
Resumo:
Energies of muonic X-rays of the K-series of carbon, nitrogen and oxygen have been measured with an accuracy of about 15 eV. Root mean square radii of the nuclear charge distributions were deduced. The results 2.49±0.05 fm for carbon, 2.55 ±0.03 fm for nitrogen and 2.71 ±0.02 fm for oxygen are in good agreement at comparable accuracy with recent electron scattering data.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.
Resumo:
Primary beam spectra were obtained for an X-ray industrial equipment (40-150 kV), and for a clinical mammography apparatus (25-35 kV) from beams scattered at angles close to 90 degrees, measured with a CdTe Compton spectrometer. Actual scattering angles were determined from the Compton energy shift of characteristic X-rays or spectra end-point energy. Evaluated contribution of coherent scattering amounts to more than 15% of fluence in mammographic beams. This technique can be used in clinical environments. (C) 2010 Elsevier Ltd. All rights reserved.
Resumo:
The protective shielding design of a mammography facility requires the knowledge of the scattered radiation by the patient and image receptor components. The shape and intensity of secondary x-ray beams depend on the kVp applied to the x-ray tube, target/filter combination, primary x-ray field size, and scattering angle. Currently, shielding calculations for mammography facilities are performed based on scatter fraction data for Mo/Mo target/filter, even though modern mammography equipment is designed with different anode/filter combinations. In this work we present scatter fraction data evaluated based on the x-ray spectra produced by a Mo/Mo, Mo/Rh and W/Rh target/filter, for 25, 30 and 35 kV tube voltages and scattering angles between 30 and 165 degrees. Three mammography phantoms were irradiated and the scattered radiation was measured with a CdZnTe detector. The primary x-ray spectra were computed with a semiempirical model based on the air kerma and HVL measured with an ionization chamber. The results point out that the scatter fraction values are higher for W/Rh than for Mo/Mo and Mo/Rh, although the primary and scattered air kerma are lower for W/Rh than for Mo/Mo and Mo/Rh target/filter combinations. The scatter fractions computed in this work were applied in a shielding design calculation in order to evaluate shielding requirements for each of these target/filter combinations. Besides, shielding requirements have been evaluated converting the scattered air kerma from mGy/week to mSv/week adopting initially a conversion coefficient from air kerma to effective dose as 1 Sv/Gy and then a mean conversion coefficient specific for the x-ray beam considered. Results show that the thickest barrier should be provided for Mo/Mo target/filter combination. They also point out that the use of the conversion coefficient from air kerma to effective dose as 1 Sv/Gy is conservatively high in the mammography energy range and overestimate the barrier thickness. (c) 2008 American Association of Physicists in Medicine.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)