886 resultados para scale development
Resumo:
• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.
Resumo:
Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.
Resumo:
To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas, Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
The Neonatal Screening for Inborn Errors of Metabolism of the Association of Parents and Friends of Special Needs Individuals (APAE) - Bauru, Brazil, was implanted and accredited by the Brazilian Ministry of Health in 1998. It covers about 286 cities of the Bauru region and 420 collection spots. Their activities include screening, diagnosis, treatment and assistance to congenital hypothyroidism (CH) and phenylketonuria (PKU), among others. In 2005, a partnership was established with the Department of Speech-Language Pathology and Audiology, Bauru School of Dentistry, University of São Paulo, Bauru, seeking to characterize and to follow, by means of research studies, the development of the communicative abilities of children with CH and PKU. OBJECTIVE: The aim of this study was to describe communicative and psycholinguistic abilities in children with CH and PKU. MATERIALS AND METHODS: Sixty-eight children (25 children aged 1 to 120 months with PKU and 43 children aged 1 to 60 months with CH) participated in the study. The handbooks were analyzed and different instruments were applied (Observation of Communication Behavior, Early Language Milestone Scale, Peabody Picture Vocabulary Test, Gesell & Amatruda's Behavioral Development Scale, Portage Operation Inventory, Language Development Evaluation Scale, Denver Developmental Screening Test, ABFW Child Language Test-phonology and Illinois Test of Psycholinguistic Abilities), according to the children's age group and developmental level. RESULTS: It was observed that the children with PKU and CH at risk for alterations in their developmental abilities (motor, cognitive, linguistic, adaptive and personal-social), mainly in the first years of life. Alterations in the psycholinguistic abilities were also found, mainly after the preschool age. Attention deficits, language and cognitive alterations were more often observed in children with CH, while attention deficits with hyperactivity and alterations in the personal-social, language and motor adaptive abilities were more frequent in children with PKU. CONCLUSION: CH and PKU can cause communicative and psycholinguistic alterations that compromise the communication and affect the social integration and learning of these individuals, proving the need of having these abilities assisted by a speech and language pathologist.
Resumo:
Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.
Resumo:
This work aimed to evaluate female lineage broilers for halothane sensitivity and for their susceptibility to the subsequent development of PSE meat. The halothane test was carried out in an anesthetic chamber with 3.0% halothane. The unconscious birds were examined for leg muscle rigidity. If one or both legs became extended and rigid, the birds were classified as halothane sensitive (HAL+), while unresponsive birds were classified as halothane negative (HAL-). The results showed that of 298 birds aged 42 days old, 95.6% were HAL- and 4.4% were HAL+. A sample of pectoralis major muscle was collected from HAL- (n=105) and HAL+ (n=13) birds. The pH and breast fillet color were determined at 4ºC, 24 hours post-mortem. Interestingly, only 2.5% of HAL+ birds displayed PSE meat characteristics compared to 12.7% of HAL- individuals. The halothane test demonstrated that female lineage broilers displayed very little sensitivity towards halothane, indicating that the development of PSE meat is related to other environmental factors.