Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Time trends and predictors of mortality from ill-defined causes in old age: 9 year folllow-up of the Bambuí cohort study (Brazil)

The study objective was to examine differentials in time trends and predictors of deaths assigned to symptoms, signs and ill-defined conditions in comparison with other ill-defined conditions (ill-defined cardiovascular diseases, cancer and injury) in a population-based cohort study. Of 1,606 baseline participants aged 60 years and over, 524 died during 9-year follow-up and were included in this study. Deaths coded to "symptoms" declined by 77% in the period from 1997-1999 to 2003-2005. Deaths coded to other ill-defined conditions remained unchanged. The calendar period 2003-2005 (RR = 0.25; 95%CI: 0.09-0.70) and in-hospital deaths (RR = 0.16; 95%CI: 0.08-0.34) were independently associated with "symptoms", but not with other ill-defined conditions. Baseline socio-demographic characteristics and chronic diseases were not predictors of these outcomes. International and national agencies have focused on the reduction of deaths assigned to "symptoms" to improve the registration of vital statistics, while other ill-defined conditions have received little attention. Our data provide evidence supporting the need to redress this situation.

Causas múltiplas de morte relacionadas às doenças cerebrovasculares no Estado do Paraná

OBJETIVO: Identificar as causas associadas de morte e o número de causas informadas nas declarações de óbito por doenças cerebrovasculares entre residentes no Estado do Paraná. MATERIAL E MÉTODOS: O banco de dados de mortalidade do ano de 2004 foi obtido do Sistema de Informação de Mortalidade disponível no endereço eletrônico do Datasus. A população escolhida foi separada pelo programa TabWin e as causas múltiplas foram processadas pelo programa Tabulador de Causas Múltiplas de Morte. RESULTADOS: O número médio de causas informadas foi de 2,92 para as mulheres e 2,97 para os homens. A maioria dos óbitos (74,8%) foi de pessoas com 65 anos ou mais de idade. Entre as causas associadas aos óbitos por doenças cerebrovasculares se destacaram as doenças do aparelho respiratório (37,9%), as doenças hipertensivas (37,5%) e os sintomas, sinais e achados anormais de exames clínicos e de laboratório (32,3%). CONSIDERAÇÕES FINAIS: Foi observada relativa melhora na qualidade dos dados de mortalidade em relação ao número de causas citadas. A hipertensão arterial como uma das principais causas associadas sugere a necessidade do seu controle no combate à mortalidade por doenças cerebrovasculares. Incentivos devem ser promovidos para estudos com causas múltiplas, para que se utilizem melhor informações tão importantes, que são desprezadas em estudos de mortalidade feitos somente com a causa básica de morte.

Mortalidade feminina por hipertensão: análise por causas múltiplas

INTRODUÇÃO: A prevalência da hipertensão arterial vem crescendo no país, constituindo-se em um problema de saúde pública por sua magnitude e dificuldades no controle. OBJETIVO: Avaliar a qualidade dos dados sobre hipertensão como causa de morte e verificar o ganho de informação na mortalidade por hipertensão arterial de mulheres de 10 a 49 anos, por meio da metodologia de análise por causas múltiplas de morte. MATERIAL E MÉTODOS: Foi constituída uma base de dados com 7.332 óbitos ocorridos no primeiro semestre de 2002 pertencentes ao "Estudo da Morbi-Mortalidade de Mulheres de 10 a 49 anos". A metodologia RAMOS (Reproductive Age Mortality Survey) foi aplicada em todas as capitais de Estados brasileiros e Distrito Federal. Com as informações adicionais, foi preenchida uma nova declaração de óbito - DO-NOVA. Foram analisados dois conjuntos de dados (DO-ORIGINAL - antes da investigação - e DO-NOVA - após resgate das informações. Foram realizadas comparações segundo causas básicas e múltiplas por fontes dos dados (DO-O, DO-N). RESULTADOS E CONCLUSÃO: A DO-ORIGINAL apresentou algumas falhas quantitativas e qualitativas. Concluiu-se que a análise por causas múltiplas enriquece a informação, com base nas DO. São necessárias ações contínuas para um melhor preenchimento da DO, pelos médicos, e deve haver mais estudos que adotem a metodologia de causas múltiplas.

Childhood and adolescent obesity and adult mortality: a systematic review of cohort studies

This systematic review addressed cohort studies on obesity in childhood and adolescence and adult mortality, published from January 1990 to March 2007. We searched the PubMed database with the following uniterms: obesity, mortality, child, adolescent; obesity and mortality; overweight and mortality. References were also analyzed. The age limit was 2 to 18 years. Quality of the articles was assessed, and eight were identified and reviewed. All used weight and stature for determination of obesity, and seven used body mass index (BMI). The quality score varied from 9 to 17. Evidence of association between obesity in childhood and adolescence and adult mortality should be viewed with caution. Use of BMI and potential confounders were discussed. Further research is needed to analyze the relationship between childhood and adolescent obesity and adult mortality.

Informação em mortalidade: o uso das regras internacionais para a seleção da causa básica

A análise da mortalidade tem sido muito usada em saúde pública, e a causa básica da morte é uma variável bastante estudada. Na maioria dos países, há obrigatoriedade de o médico preencher a declaração de óbito (DO), informando às autoridades a ocorrência do evento, características do falecido e causas da morte. Quando há dois ou mais diagnósticos na declaração das causas da morte, surge a questão da seleção da causa básica. As normas para o preenchimento das causas de morte pelos médicos nas DO e as regras para a seleção da causa básica, quando mais de uma causa é declarada, estão definidas pela OMS, visando à comparabilidade internacional. O objetivo deste trabalho é avaliar se a aplicação das Regras Internacionais de Classificação da causa básica permite a seleção da real causa básica, mesmo se declarada incorretamente pelo médico. O material pertence ao "Estudo sobre a mortalidade de mulheres em idade fértil", sendo que 1.315 casos satisfizeram os requisitos de inclusão. Para cada morte foi realizada uma investigação através de entrevistas domiciliárias, consultas aos prontuários hospitalares e assemelhados. Médicos treinados e calibrados preenchiam uma DO nova, após a leitura de toda a informação, e selecionavam a "verdadeira" causa básica da morte. Esta era comparada com a causa básica da DO original, obtida por meio das Regras Internacionais. Entre as DO, em 1.192 (90,6%) houve concordância com a verdadeira causa básica obtida após a investigação. Concluiu-se que as Regras Internacionais permitem selecionar a real causa básica, mesmo quando o médico preenche inadequadamente a DO

Tendência da mortalidade relacionada à doença de Chagas, Estado de São Paulo, Brasil, 1985 a 2006: estudo usando causas múltiplas de morte

OBJETIVO: Estudar a tendência da mortalidade relacionada à doença de Chagas informada em qualquer linha ou parte do atestado médico da declaração de óbito.MÉTODOS: Os dados provieram dos bancos de causas múltiplas de morte da Fundação Sistema Estadual de Análise de Dados de São Paulo (SEADE) entre 1985 e 2006. As causas de morte foram caracterizadas como básicas, associadas (não-básicas) e total de suas menções.RESULTADOS: No período de 22 anos, ocorreram 40 002 óbitos relacionados à doença de Chagas, dos quais 34 917 (87,29%) como causa básica e 5 085 (12,71%) como causa associada. Foi observado um declínio de 56,07% do coeficiente de mortalidade pela causa básica e estabilidade pela causa associada. O número de óbitos foi 44,5% maior entre os homens em relação às mulheres. O fato de 83,5% dos óbitos terem ocorrido a partir dos 45 anos de idade revela um efeito de coorte. As principais causas associadas da doença de Chagas como causa básica foram as complicações diretas do comprometimento cardíaco, como transtornos da condução, arritmias e insuficiência cardíaca. Para a doença de Chagas como causa associada, foram identificadas como causas básicas as doenças isquêmicas do coração, as doenças cerebrovasculares e as neoplasias.CONCLUSÕES: Para o total de suas menções, verificou-se uma queda do coeficiente de mortalidade de 51,34%, ao passo que a queda no número de óbitos foi de apenas 5,91%, tendo sido menor entre as mulheres, com um deslocamento das mortes para as idades mais avançadas. A metodologia das causas múltiplas de morte contribuiu para ampliar o conhecimento da história natural da doença de Chagas

Acidentes de trânsito causando vítimas: possível reflexo da lei seca nas internações hospitalares

Os acidentes de trânsito no Brasil se constituem em relevante problema para a área da saúde. Nesse sentido, julgou-se importante investigar qual o efeito da lei 11.705 de 19 de junho de 2008, a chamada Lei seca. A metodologia do trabalho constitui analisar os dados do Sistema de Informações Hospitalares do SUS, para o Brasil, em 2008, comparando as internações nos dois semestres do ano, segundo algumas variáveis consideradas importantes. Os resultados mostraram que houve uma queda de 28,3 por cento nas internações do segundo semestre, com reflexos consideráveis em todas as variáveis estudadas. Quanto à qualidade da vítima, a maior queda ocorreu entre os ocupantes de automóvel, principalmente do sexo masculino. Em relação às idades, houve declínio em todas as faixas, destacando-se as de 40 a 59 anos e 20 a 39 anos, pela ordem. O tempo de permanência na instituição foi menor no segundo semestre,quando a mortalidade hospitalar declinou 13,6 por cento em relação ao primeiro semestre, o que significa que deixaram de morrer 917 pessoas (cerca de 5 mortes/dias). O gasto governamental para o atendimento dos feridos no segundo semestre foi 35,5 por cento menor do que no primeiro

A mortalidade de idosos no Brasil: a questão das causas mal definidas

O envelhecimento populacional é um fato marcante da transição demográfica. O estudo das causas básicas em idosos permite visualizar seu perfil epidemiológico, embora possa ser prejudicado pela alta proporção de causas mal definidas. O objetivo deste trabalho é descrever a mortalidade dos idosos por essas causas no Brasil. A fonte dos dados foi o Sistema de Informações sobre Mortalidade do Ministério da Saúde.Entre as variáveis, a principal modalidade foi a causa básica mal definida [ Capítulo XVIII da Classificação Estatística Internacional de Doenças e Problemas Relacionados à Saúde-Décima Revisão (CID-10)]. O decréscimo desses óbitos em idosos foi de 35 por cento entre 1996 e 2005.Considerando os óbitos de 60 a 69 anos e os de 80 e mais anos, as proporções de mal definidos aumentaram em 9,9 por cento e 14,8 por cento, respectivamente, no ano de 2005. Métodos visando a sua diminuição são sugeridos, salientando-se que o fato mais importante é o de os médicos preencherem adequadamente as declarações de óbito- com as reais causas básicas, conseqüênciais e terminais-, objetivo maior dos estudiosos

Mortes maternas e mortes por causas maternas

Ao mensurar-se mortalidade materna, é necessário distinguir ' mortes por causas maternas' e 'mortes maternas' Para a Organização Mundial da Saúde-OMS-,mortes maternas são as que ocorrem na gestação, no parto e até 42 dias após o parto; e mortes por causas maternas englobam as causas classificadas no Capítulo XV da Classificação Estatística Internacional de Doenças e Problemas Relacionados à Saúde, Décima Revisão (CID-10), incluindo as ocorridas quando passados 42 dias do parto. Apresentam-se resultados da investigação de mortes femininas em idade fértil-10 a 49 anos- nas capitais de Estados e no Distrito Federal do Brasil, em 2002. Adotou-se a metodologia RAMOS, comparando-se as causas básicas das declarações de óbito originais com as das declarações preenchidas após o resgate de informações, obtidas em entrevistas domiciliares e prontuários. Entre as mortes por causas maternas originais, 15,9 por cento não eram mortes maternas, de acordo com a definição da OMS. Houve, concomitantemente, subenumeração de mortes maternas. Sugestões são feitas para melhorar o preenchimento das declarações de óbito e inclusão de novas categorias na CID-10, visando melhorar a informação das causas maternas

Echocardiographic study of paediatric patients with mucopolysaccharidosis

Principle Mucopolysaccharidosis is an inborn error of metabolism causing glucosaminoglycans tissue storage. Cardiovascular involvement is variable but contributes significantly towards the morbidity and mortality of the patients. Objective To characterise the echocardiographic abnormalities in children and adolescents with different types of mucopolysaccharidosis. Method Echocardiograms and medical records of 28 patients aged 2–14 years, seen from 2003 to 2005, were revised. At that time, the enzymatic replacement therapy was still not available in our institution.Results Echocardiographic alterations were detected in 26 patients (93 per cent), whereas 16 (57 per cent) had abnormal auscultation, and only 6 (21 per cent) presented with cardiovascular complaint. Mitral valve thickening with dysfunction (regurgitation, stenosis, or double lesion) was diagnosed in 60.8 per cent, left ventricular hypertrophy in 43 per cent and aortic valve thickening with regurgitation in 35.8 per cent of the patients. There was no systolic dysfunction and mild left diastolic dysfunction was shown in 21.5 per cent of the patients. Pulmonary hypertension was present in 36 per cent of the patients, causing the only two deaths recorded. There was a strong association between the accumulation of dermatan sulphate and the presence of mitral valve dysfunction (p = 0.0003), aortic valve dysfunction (p = 0.006), and pulmonary hypertension (p = 0.006). Among individuals with two or more examinations, 82 per cent had a worsening evolution. Conclusions Echocardiographic alterations in children with Mucopolysaccharidosis are frequent and have a progressive character Left valve lesions, ventricular hypertrophy, and pulmonary hypertension were the most common findings and there was an association between the accumulation of dermatan sulphate and cardiovascular involvement. Unlike in adults, pulmonary hypertension was the main cause of death, not left ventricle systolic dysfunction

Traffic-Related Air Pollution and Perinatal Mortality: A Case-Control Study

BACKGROUND: Ambient levels of air pollution may affect the health of children, as indicated by studies of infant and perinatal mortality. Scientific evidence has also correlated low birth weight and preterm birth, which are important determinants of perinatal death, with air pollution. However, most of these studies used ambient concentrations measured at monitoring sites, which may not consider differential exposure to pollutants found at elevated concentrations near heavy-traffic roadways. OBJECTIVES: Our goal was to examine the association between traffic-related pollution and perinatal mortality. METHODS: We used the information collected for a case-control study conducted in 14 districts in the City of Sao Paulo, Brazil, regarding risk factors for perinatal deaths. We geocoded the residential addresses of cases (fetal and early neonatal deaths) and controls (children who survived the 28th day of life) and calculated a distance-weighted traffic density (DWTD) measure considering all roads contained in a buffer surrounding these homes. RESULTS: Logistic regression revealed a gradient of increasing risk of early neonatal death with higher exposure to traffic-related air pollution. Mothers exposed to the highest quartile of the DWTD compared with those less exposed exhibited approximately 50% increased risk (adjusted odds ratio = 1.47; 95% confidence interval, 0.67-3.19). Associations for fetal mortality were less consistent. CONCLUSIONS: These results suggest that motor vehicle exhaust exposures may be a risk factor for perinatal mortality.

Trends in socioeconomic inequalities in cancer mortality in Barcelona: 1992-2003

Background: The objective of this study was to assess trends in cancer mortality by educational level in Barcelona from 1992 to 2003. Methods: The study population comprised Barcelona inhabitants aged 20 years or older. Data on cancer deaths were supplied by the system of information on mortality. Educational level was obtained from the municipal census. Age-standardized rates by educational level were calculated. We also fitted Poisson regression models to estimate the relative index of inequality (RII) and the Slope Index of Inequalities (SII). All were calculated for each sex and period (1992-1994, 1995-1997, 1998-2000, and 2001-2003). Results: Cancer mortality was higher in men and women with lower educational level throughout the study period. Less-schooled men had higher mortality by stomach, mouth and pharynx, oesophagus, larynx and lung cancer. In women, there were educational inequalities for cervix uteri, liver and colon cancer. Inequalities of overall and specific types of cancer mortality remained stable in Barcelona; although a slight reduction was observed for some cancers. Conclusion: This study has identified those cancer types presenting the greatest inequalities between men and women in recent years and shown that in Barcelona there is a stable trend in inequalities in the burden of cancer.

Neoplasia and paracoccidioidomycosis

Published studies on the association between cancer and paracoccidioidomycosis consist either isolated cases or clinical data based on hospital cohorts of paracoccidioidomycosis. The frequency of neoplasia in series of >= 80 patients with paracoccidioidomycosis ranges from 0.16 to 14.1%, mean of 3.96%. There are only two retrospective controlled studies, one of them showing greater incidence of carcinoma in biopsy and necropsy samples of paracoccidioidomycosis (12 cases in 147 patients with the mycosis: 8.2%) than in the necropsies of the control group (320 cases in 7,302 necropsies: 4.9%). In the other, 22,409 autopsies were reviewed and 4,372 cases of cancer were found; of the 85 patients with paracoccidioidomycosis, 12 were diagnosed with cancer. No differences were observed in the frequency of malignancies between the group of patients with paracoccidioidomycosis (14.1%) and the control group (19.5%). Considering all the reported cases, carcinoma was more frequent than hematological malignancies, and was more often found at the same site or in a neighboring site affected by the mycosis, usually occurring after the diagnosis of the mycosis. Commonly, the basic cause of death was related to secondary infections or neoplasia. Lymphoma was associated with poorly organized rich in fungi granuloma. The clinical course and mortality were related to the cancer evolution or secondary infections and was worse in lymphoid series, metastatic carcinoma or in patients under cytotoxic chemotherapy. Additionally, as in several cases the clinical and histopathological data may mimick neoplasia, the correct diagnosis of both diseases is essential to guarantee an early and safe intervention.

The azo dye Disperse Orange 1 induces DNA damage and cytotoxic effects but does not cause ecotoxic effects in Daphnia similis and Vibrio fischeri

Azo dyes constitute the largest group of colorants used in industry and can pass through municipal waste water plants nearly unchanged due to their resistance to aerobic treatment, which potentially exposes humans and local biota to adverse effects. Unfortunately, little is known about their environmental fate. Under anaerobic conditions, some azo dyes are cleaved by microorganisms forming potentially carcinogenic aromatic amines. In the present study, the azo dye Disperse Orange 1, widely used in textile dyeing, was tested using the comet, Salmonella/microsome mutagenicity, cell viability, Daphnia similis and Microtox (R) assays. The human hepatoma cell line (HepG2) was used in the comet assay and for cell viability. In the mutagenicity assay. Salmonella typhimurium strains with different levels of nitroreductase and o-acetyltransferase were used. The dye showed genotoxic effects with respect to HepG2 cells at concentrations of 0.2, 0.4, 1.0, 2.0 and 4.0 mu g/mL. In the mutagenicity assay, greater responses were obtained with the strains TA98 and YG1041, suggesting that this compound mainly induces frameshift mutations. Moreover, the mutagenicity was greatly enhanced with the strains overproducing nitroreductase and o-acetyltransferase, showing the importance of these enzymes in the mutagenicity of this dye. In addition, the compound induced apoptosis after 72 h in contact with the HepG2 cells. No toxic effects were observed for either D. similis or Vibrio fischeri. (C) 2011 Elsevier B.V. All rights reserved.