884 resultados para Fruit beverages


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Dental erosion is highly prevalent today, and acidic drinks are thought to be an important cause. The aim of the present investigation was to determine the erosive potential of a range of common beverages on extracted human teeth. Methods: The beverages were tested for their individual pHs using a pH meter. The clinical effects of the most erosive beverages were determined by the degree of etching and Vickers microhardness of enamel. Results: The results showed that many common beverages have pHs sufficiently low to cause enamel erosion. Lime juice concentrate (pH 2.1) had the lowest pH, followed by Coca-cola and Pepsi (both with pH 2.3) and Lucozade (pH 2.5). The erosive potential of these beverages was demonstrated by the deep etching of the enamel after five minutes. The Vickers Hardness of enamel was reduced by about 50 per cent is the case of lime juice (p < 0.001) and 24 per cent in the case of Coca-cola (p < 0.004). Addition of saliva to 50 per cent (v/v) of Coca-cola completely reversed the erosive effects on the enamel. Conclusion: Although only a few of the beverages with the lowest pHs were tested, the present study showed that the most acidic drinks had the greatest erosive effects on enamel. While saliva was protective against erosion, relatively large volumes were required to neutralize the acidity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Arsenic is a human carcinogen that has been found in various waters and wines throughout the world. Therefore, close examination of these liquids is necessary to prevent the intoxication of animals and humans. Wines and waters often contain significant amounts of toxic arsenic species. The source of arsenic in wines and waters is generally believed to be the result of arsenic-based pesticides and herbicides. Recent studies have also shown that toxic arsenic may be used in the cultivation and acceleration of the ripening process of fruit, ultimately contaminating fruit-based beverages. The determination of total arsenic can be found by using several methods, including AFS or ICP/MS. No pretreatment of water is necessary, except for filtering by means of a Fisherbrand PTFE 0.45 connected to a Becton-Dickinson 10 mL syringe to filter particles from water. The pretreatment of the wine includes ethanol evaporation and an addition of 0.1% nitric acid. A number of commercial drinking waters and regional lake water were analyzed. Since we have confirmed the presence of arsenic in a variety of waters and wines from different countries, we decided to test a number of commercially available beverages for the presence of arsenic. The focus ofthis project is to establish the presence of arsenic in various commercially available beverages. ICP-MS was used to determine total arsenic using certified standards. Internal standards Indium and Yttrium were also used to verify the concentration readings, which varied from 0- 20 ppb.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Introduction: Type and quantity of beverages intake among adolescents may influence their hydration status. Objective: To evaluate the association between hydration status assessed by Free Water Reserve (FWR) and consumption of 5 types of beverages (water, milk, soft drinks, fruit juices and hot beverages). Conclusions: In this sample of participants, euhydrated adolescents ingest more water and hot beverages than those at risk of hypo-hydration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated the influence of a cola-type soft drink and a soy-based orange juice on the surface and subsurface erosion of primary enamel, as a function of the exposure time. Seventy-five primary incisors were divided for microhardness test (n=45) or scanning electron microscopy (SEM) analysis (n=30). The specimens were randomly assigned to 3 groups: 1 - artificial saliva (control); 2 - cola-type soft drink; and 3 - soy-based orange juice. Immersion cycles in the beverages were undertaken under agitation for 5 min, 3 times a day, during 60 days. Surface microhardness was measured at 7, 15, 30, 45 and 60 days. After 60 days, specimens were bisected and subsurface microhardness was measured at 30, 60, 90, 120, 150 and 200 µm from the surface exposed. Data were analyzed by ANOVA and Tukey’s test (a=0.05). Groups 2 and 3 presented similar decrease of surface microhardness. Regarding subsurface microhardness, group 2 presented the lowest values. SEM images revealed that after 60 days the surfaces clearly exhibited structural loss, unlike those immersed in artificial saliva. It may be concluded that erosion of the surfaces exposed to the cola-type soft drink was more accentuated and directly proportional to the exposure time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJETIVO: Analisar o consumo de frutas, verduras e legumes em mulheres, segundo fatores sócio-demográficos, econômicos e comportamentais. MÉTODOS: A amostra foi constituída de 311 mulheres de três áreas de estudo, do município de Cotia, na área metropolitana de São Paulo, selecionadas por amostragem por conglomerado em dois estágios. O consumo de frutas, verduras e legumes foi avaliado por questionário de freqüência alimentar. Os diferenciais de consumo foram estudados por análise multivariada de regressão logística. RESULTADOS: A chance de baixo consumo de frutas foi maior nas mulheres do bairro pobre, com baixa escolaridade, donas de casa e desempregadas, com baixa renda familiar e tabagistas. Os diferenciais de consumo de verduras foram associados mais à cultura alimentar do que à pobreza: as mais jovens apresentaram chances sensivelmente maiores de baixo consumo de verduras. O tabagismo e o sedentarismo associaram-se ao baixo consumo. Os legumes foram associados tanto ao nível socioeconômico, quanto à cultura alimentar. Foram pouco consumidos pelas mulheres mais jovens e, de um modo geral, por aquelas de pouca escolaridade e baixa renda familiar. Também, o etilismo e o sedentarismo aumentaram as chances de baixo consumo desses alimentos. CONCLUSÃO: O consumo de frutas, verduras e legumes apresentou diferenciais relacionados ao nível socioeconômico, à cultura alimentar e aos hábitos comportamentais.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJETIVO: Avaliar qualitativamente a composição das lancheiras de crianças do segundo ao quinto ano do ensino fundamental de escolas privadas de São Paulo. MÉTODOS: O delineamento do estudo foi transversal e a coleta de dados foi realizada em cinco unidades de uma rede particular de ensino, localizadas em regiões distintas da Grande São Paulo. A observação dos lanches ocorreu em três dias não consecutivos do ano de 2008 para cada criança. A amostra foi constituída pela totalidade de crianças do segundo ao quinto ano do ensino fundamental (n=501). Os alunos foram categorizados segundo a presença ou não de cada um dos grupos de alimentos nas lancheiras em pelo menos um dos três dias de observação. RESULTADOS: Dentre as crianças estudadas, 82% trouxeram cereais; 67% sucos artificiais e outras bebidas; 65% leite e alimentos lácteos; 51% bolo, bolacha e barra de cereais recheados e/ou com cobertura e 35% embutidos, em pelo menos uma dia de coleta. A frequência de frutas e sucos naturais foi de 33%, e de verduras e legumes foi de 4%. Meninas levaram para a escola com mais frequência frutas e hortaliças (p<0,05). Alunos maiores deixaram de levar lanche à escola mais frequentemente do que os menores nos três dias de observação (11 e 4%, respectivamente; p<0,05). CONCLUSÕES: A composição das lancheiras dos escolares, apesar de alguns aspectos positivos, mostrou-se inadequada. Houve excesso de alimentos industrializados, geralmente ricos em açúcares, gorduras e sódio e baixa presença de frutas, verduras e legumes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJETIVO: Avaliar o consumo de bebidas e refrigerantes por adolescentes de uma escola pública de São Paulo (SP). MÉTODOS: Participaram do estudo 71 adolescentes com idade entre 14 e 17 anos, de ambos os gêneros, matriculados no ensino médio em uma escola técnica da região metropolitana de São Paulo. Avaliaram se o tipo de bebida consumida durante as refeições, os locais onde se consome refrigerante e o motivo que leva ao consumo. RESULTADOS: A bebida mais consumida durante as refeições foi o suco de frutas industrializado (38,1%), seguido do refrigerante do tipo comum (28,6%) e do suco de frutas natural (22,2%). Os locais do consumo de refrigerantes foram a casa (38,2%), seguida da escola (22,1%). O principal fator apontado para o consumo de refrigerantes foi o sabor (75,4%). CONCLUSÕES: O consumo de bebidas açucaradas foi frequente entre adolescentes, especialmente o refrigerante. Essas bebidas são disponíveis e consumidas tanto em casa como na escola e consideradas saborosas. Os programas de educação nutricional devem pensar em como priorizar o consumo de outras bebidas, além de controlar a comercialização de refrigerantes nas escolas, com o objetivo de estimular o consumo de bebidas mais saudáveis para essa faixa etária.