Production Of Microparticles With Gelatin And Chitosan.

In the past few decades, the textile industry has significantly increased investment in research to develop functional fabrics, with a special focus on those aggregating values. Such fabrics can exploit microparticles inferior to 100 μm, such as those made by complex coacervation in their creation. The antimicrobial properties of chitosan can be attributed to these microparticles. Developing particles with uniform structure and properties would facilitate the control for the eventual release of the core material. Thus, a complex coacervation between gelatin and chitosan was studied, and the optimal conditions were replicated in the encapsulation of limonene. Spherical particles formed had an average diameter (D3,2) of 30 μm and were prepared with 89.7% efficiency. Cross-linking of these microparticles using glutaraldehyde and tripolyphosphate was carried out before spray drying. After drying, microparticles cross-linked with glutaraldehyde were oxidized and clustered and those that were cross-linked with tripolyphosphate resisted drying and presented a high yield.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

The Influence Of The Buffering Capacity On The Production Of Organic Acids And Alcohols From Wastewater In Anaerobic Reactor.

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Pectinases: aplicações industriais e perspectivas

Pectic substances are structural heteropolysaccharides that occur in the middle lamellae and primary cell walls of higher plants. They are composed of partially methyl-esterified galacturonic acid residues linked by alpha-1, 4-glycosidic bonds. Pectinolytic enzymes are complex enzymes that degrade pectic polymers and there are several classes of enzymes, which include pectin esterases, pectin and pectate lyases and polygalacturonases. Plants, filamentous fungi, bacteria and yeasts are able to produce pectinases. In the industrial world, pectinases are used in fruit juice clarification, in the production of wine, in the extraction of olive oil, fiber degumming and fermentation of tea, coffee and cocoa.

Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Abundância de ramos reprodutivos e produção de sementes em populações de Ipomoea pes-caprae (L.) R. Br. na Ilha de Santa Catarina, Brasil

The variation in the proportion of reproductive branches, fruit, and seed production of Ipomoea pes-caprae (L.) R. Br. (Convolvulaceae) were evaluated at ten beaches on Santa Catarina Island, state of Santa Catarina, Brazil. Three patches per beach of Ipomoea pes-caprae were monitored, involving two reproductive cycles. Ipomoea pes-caprae presented initially an average length of patches of 14 m, with 9.6 branches/m² and 39% of reproductive branches. The proportion of reproductive branches varied between the cycles, but there was not noticed an alternation of reproductive effort between the subsequent cycles. There was a reduction in the percentage of reproductive branches at six localities. In four beaches where Ipomoea pes-caprae populations declined, occurred reduction in the reproductive vigor, and in the seed production, being these declines associated to strong sea erosion. In another hand, in one beach with population increase, there were little reproductive branches due to the occurrence of young stolons. Four patches never maturated fruits, being three of these located at small beaches. The fruit and seed productions in the patches showed values up to 40 fruits/m² and up to 140 seeds/m², respectively. Populations with great seed production were localized in areas adjacent to great coastal plains, which may represent potential seed sources for areas with small seed production in the island.

Aspectos ultra-estruturais dos canais secretores em órgãos vegetativos e reprodutivos de Anacardiaceae

The study assessed phloem canal development and ultra-structure in shoot apices of Spondias dulcis G. Forst., phloematic canal ultra-structure in shoot apices of Tapirira guianensis Aubl., and floral canal ultra-structure and development and fruit canal ultra-structure of the latter specie. The flower and fruit canals of Anacardium humile St.Hil. were also studied ultra-structurally. The canals in shoot apices of S. dulcis show schizo-lysigenous formation and the floral canals of T. guianensis show schizogenous development. Epithelial cells of S. dulcis and T. guianensis canals have rough endoplasmic reticulum, free ribosomes, elongated plastids of several shapes with osmiophilic inclusions and dictyosomes with production of vesicles. Such organelles participate in the secretion of a heterogeneous exudate, which is comprised of hydrophilic and lipophilic substances. The epithelial cells of the fruit of A. humile present elongated plastids with circular membrane system, which are involved in the synthesis of lipophilic substances. The results of the ultra-structural analyses of the epithelial cells corroborate the results previously obtained in a histochemical study. In the histochemical study, lipophilic and hydrophilic substances were identified in the canals of T. guinanensis and S. dulcis and only lipophilic substances were identified in the canals of A. humile. Based on the ultrastructural aspects of the secretory canals of T. guianensis and S. dulcis we concluded that the plastids of the epithelial cells of the two species are different although they produce secretion of similar composition. A new record for the family is the presence of a great number of circular plastids in epithelial cells of the fruit of Anacardium humile. The pattern found in the secretory canals of the studied species is the ecrine type of secretion release.

Ambientes de cultivo, recipientes e substratos na produção de biomassa foliar e radicular em mudas de maracujazeiro amarelo em Aquidauana - MS

The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Analise do desenvolvimento das praticas urbanas de lazer relacionadas a produção cultural no periodo nacional-desenvolvimentista a globalização atraves da Teoria da Ação Comunicativa

Universidade Estadual de Campinas . Faculdade de Educação Física

Production and body composition traits of broilers in relation to breast weight evaluated by path analysis

Breast weight has great economic importance in poultry industry, and may be associated with other variables. This work aimed to estimate phenotypic correlations between performance (live body weight at 7 and 28 days, and at slaughter, and depth of the breast muscle measured by ultrasonography), carcass (eviscerated body weight and leg weight) and body composition (heart, liver and abdominal fat weight) traits in a broiler line, and quantify the direct and indirect influence of these traits on breast weight. Path analysis was used by expanding the matrix of partial correlation in coefficients which give the direct influence of one trait on another, regardless the effect of the other traits. The simultaneous maintenance of live body weight at slaughter and eviscerated body weight in the matrix of correlations might be harmful for statistical analysis involving systems of normal equations, like path analysis, due to the observed multicollinearity. The live body weight at slaughter and the depth of the breast muscle as measured by ultrasonography directly affected breast weight and were identified as the most responsible factors for the magnitude of the correlation coefficients obtained between the studied traits and breast weight. Individual pre-selection for these traits could favor an increased breast weight in the future reproducer candidates of this line if the broilers' environmental conditions and housing are maintained, since the live body weight at slaughter and the depth of breast muscle measured by ultrasonography were directly related to breast weight.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.