986 resultados para Protein detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Crohn´s disease (CD) is a chronic transmural inflammation of the gastrointestinal tract of unknown cause. Malnutrition associated with active CD has been reduced although obesity has increased. Dietary strategies such as those with high-protein have been proposed to reduce body fat. This study compares the effects of two supplements on the nutritional status of CD patients. 68 CD patients were randomized in two groups: whey protein group (WP) and soy protein group (SP). Using bioimpedance analysis, anthropometry and albumin and pre-albumin dosages the nutritional status was measured before starting the intervention and after 8 and 16 weeks. The disease activity was determined by Crohn's Disease Activity Index and serum C-reactive protein dosage and dietary intake by 24h dietary recalls. Forty-one patients concluded the study and both supplements changed body composition similarly. Triceps skin fold thickness (p< 0.001) and body fat percentage (p=0.001) decreased, whereas mid-arm muscle circumference (p=0.004), corrected arm muscle area (p=0.005) and body lean percentage (p=0.001) increased. For Crohn's disease patients undergoing anti TNF-alpha and azatioprine therapies, supplementation with whey and soy proteins changes body composition through reduction of body fat and thus contributes to control inflammation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phosphatases have long been regarded as tumor suppressors, however there is emerging evidence for a tumor initiating role for some phosphatases in several forms of cancer. Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP; acid phosphatase 1 [ACP1]) is an 18 kDa enzyme that influences the phosphorylation of signaling pathway mediators involved in cancer and is thus postulated to be a tumor-promoting enzyme, but neither unequivocal clinical evidence nor convincing mechanistic actions for a role of LMWPTP have been identified. In the present study, we show that LMWPTP expression is not only significantly increased in colorectal cancer (CRC), but also follows a step-wise increase in different levels of dysplasia. Chemical inhibition of LMWPTP significantly reduces CRC growth. Furthermore, downregulation of LMWPTP in CRC leads to a reduced migration ability in both 2D- and 3D-migration assays, and sensitizes tumor cells to the chemotherapeutic agent 5-FU. In conclusion, this study shows that LMWPTP is not only overexpressed in colorectal cancer, but it is correlated with the malignant potential of this cancer, suggesting that this phosphatase may act as a predictive biomaker of CRC stage and represents a rational novel target in the treatment of this disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Maternal high-fat diet (HFD) impairs hippocampal development of offspring promoting decreased proliferation of neural progenitors, in neuronal differentiation, in dendritic spine density and synaptic plasticity reducing neurogenic capacity. Notch signaling pathway participates in molecular mechanisms of the neurogenesis. The activation of Notch signaling leads to the upregulation of Hes5, which inhibits the proliferation and differentiation of neural progenitors. This study aimed to investigate the Notch/Hes pathway activation in the hippocampus of the offspring of dams fed an HFD. Female Swiss mice were fed a control diet (CD) and an HFD from pre-mating until suckling. The bodyweight and mass of adipose tissue in the mothers and pups were also measured. The mRNA and protein expression of Notch1, Hes5, Mash1, and Delta1 in the hippocampus was assessed by RT-PCR and western blotting, respectively. Dams fed the HFD and their pups had an increased bodyweight and amount of adipose tissue. Furthermore, the offspring of mothers fed the HFD exhibited an increased Hes5 expression in the hippocampus compared with CD offspring. In addition, HFD offspring also expressed increased amounts of Notch1 and Hes5 mRNA, whereas Mash1 expression was decreased. However, the expression of Delta1 did not change significantly. We propose that the overexpression of Hes5, a Notch effector, downregulates the expression of the proneural gene Mash1 in the offspring of obese mothers, delaying cellular differentiation. These results provide further evidence that an offspring's hippocampus is molecularly susceptible to maternal HFD and suggest that Notch1 signaling in this brain region is important for neuronal differentiation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVES: This study assessed the bone density gain and its relationship with the periodontal clinical parameters in a case series of a regenerative therapy procedure. MATERIAL AND METHODS: Using a split-mouth study design, 10 pairs of infrabony defects from 15 patients were treated with a pool of bovine bone morphogenetic proteins associated with collagen membrane (test sites) or collagen membrane only (control sites). The periodontal healing was clinically and radiographically monitored for six months. Standardized pre-surgical and 6-month postoperative radiographs were digitized for digital subtraction analysis, which showed relative bone density gain in both groups of 0.034 ± 0.423 and 0.105 ± 0.423 in the test and control group, respectively (p>0.05). RESULTS: As regards the area size of bone density change, the influence of the therapy was detected in 2.5 mm² in the test group and 2 mm² in the control group (p>0.05). Additionally, no correlation was observed between the favorable clinical results and the bone density gain measured by digital subtraction radiography (p>0.05). CONCLUSIONS: The findings of this study suggest that the clinical benefit of the regenerative therapy observed did not come with significant bone density gains. Long-term evaluation may lead to a different conclusions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To investigate the facial symmetry of rats submitted to experimental mandibular condyle fracture and with protein undernutrition (8% of protein) by means of cephalometric measurements. METHODS: Forty-five adult Wistar rats were distributed in three groups: fracture group, submitted to condylar fracture with no changes in diet; undernourished fracture group, submitted to hypoproteic diet and condylar fracture; undernourished group, kept until the end of experiment, without condylar fracture. Displaced fractures of the right condyle were induced under general anesthesia. The specimens were submitted to axial radiographic incidence, and cephalometric mensurations were made using a computer system. The values obtained were subjected to statistical analyses among the groups and between the sides in each group. RESULTS: There was significative decrease of the values of serum proteins and albumin in the undernourished fracture group. There was deviation of the median line of the mandible relative to the median line of the maxilla, significative to undernutrition fracture group, as well as asymmetry of the maxilla and mandible, in special in the final period of experiment. CONCLUSION: The mandibular condyle fracture in rats with proteic undernutrition induced an asymmetry of the mandible, also leading to consequences in the maxilla.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present work was to characterize changes in the protein profile throughout seed development in O. catharinensis, a recalcitrant species, by two-dimensional gel electrophoresis. Protein extraction was undertaken by using a thiourea/urea buffer, followed by a precipitation step with 10% TCA. Comparative analysis during seed development showed that a large number of proteins were exclusively detected in each developmental stage. The cotyledonary stage, which represents the transition phase between embryogenesis and the beginning of metabolism related to maturation, presents the highest number of stage-specific spots. Protein identification, through MS/MS analysis, resulted in the identification of proteins mainly related to oxidative metabolism and storage synthesis. These findings contribute to a better understanding of protein metabolism during seed development in recalcitrant seeds, besides providing information on established markers that could be useful in defining and improving somatic embryogenesis protocols, besides monitoring the development of somatic embryos in this species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, we evaluated the expression of the Zenk protein within the nucleus taeniae of the pigeon’s amygdala (TnA) after training in a classical aversive conditioning, in order to improve our understanding of its functional role in birds. Thirty-two 18-month-old adult male pigeons (Columba livia), weighing on average 350 g, were trained under different conditions: with tone-shock associations (experimental group; EG); with shock-alone presentations (shock group; SG); with tone-alone presentations (tone group; TG); with exposure to the training chamber without stimulation (context group; CG), and with daily handling (naive group; NG). The number of immunoreactive nuclei was counted in the whole TnA region and is reported as density of Zenk-positive nuclei. This density of Zenk-positive cells in the TnA was significantly greater for the EG, SG and TG than for the CG and NG (P < 0.05). The data indicate an expression of Zenk in the TnA that was driven by experience, supporting the role of this brain area as a critical element for neural processing of aversive stimuli as well as meaningful novel stimuli.