978 resultados para Revision and termination of contracts
Resumo:
Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.
Resumo:
PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas, Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.
Resumo:
The purpose of this study was to evaluate the metal-ceramic bond strength (MCBS) of 6 metal-ceramic pairs (2 Ni-Cr alloys and 1 Pd-Ag alloy with 2 dental ceramics) and correlate the MCBS values with the differences between the coefficients of linear thermal expansion (CTEs) of the metals and ceramics. Verabond (VB) Ni-Cr-Be alloy, Verabond II (VB2), Ni-Cr alloy, Pors-on 4 (P), Pd-Ag alloy, and IPS (I) and Duceram (D) ceramics were used for the MCBS test and dilatometric test. Forty-eight ceramic rings were built around metallic rods (3.0 mm in diameter and 70.0 mm in length) made from the evaluated alloys. The rods were subsequently embedded in gypsum cast in order to perform a tensile load test, which enabled calculating the CMBS. Five specimens (2.0 mm in diameter and 12.0 mm in length) of each material were made for the dilatometric test. The chromel-alumel thermocouple required for the test was welded into the metal test specimens and inserted into the ceramics. ANOVA and Tukey's test revealed significant differences (p=0.01) for the MCBS test results (MPa), with PI showing higher MCBS (67.72) than the other pairs, which did not present any significant differences. The CTE (10-6 oC-1) differences were: VBI (0.54), VBD (1.33), VB2I (-0.14), VB2D (0.63), PI (1.84) and PD (2.62). Pearson's correlation test (r=0.17) was performed to evaluate of correlation between MCBS and CTE differences. Within the limitations of this study and based on the obtained results, there was no correlation between MCBS and CTE differences for the evaluated metal-ceramic pairs.