Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Multifunctional role of steroidogenic factor 1 and disorders of sex development

Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do esporte : organização, sistematização, aplicação e avaliação de conteúdos esportivos na educação não formal = Sport pedagogy : organization, systematization and application of sports content in non-formal education

Universidade Estadual de Campinas . Faculdade de Educação Física

Democracia Corinthiana : sentidos e significados da participação dos jogadores = Corinthians democracy : meanings and significance of the players' participation

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito das sessões de familiarização sobre o pico de torque e taxa de desenvolvimento de torque : comparações entre jovens, meia idade e idosos = Effect of familiarization sessions on peak torque and rate of torque development : comparisons among young, middle age and elderly

Universidade Estadual de Campinas, Faculdade de Educação Física

Análise do desempenho muscular do quadríceps e dos isquiotibiais em função da série temporal e da amplitude de movimento de atletas amadoras de futsal feminino = : Analysis of muscle performance of the quadriceps and hamstrings as a function of the times series and range of motion of amateurfemale futsal athletes

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física

Trajetórias de vida : lembranças, caminhos e constituições dos saberes docentes de professores de Educação Física = Paths and trajectories of life : memories, paths and establishment of teaching knowledge of Physical Education Professors

Universidade Estadual de Campinas . Faculdade de Educação Física

Influência da hipermobilidade articular na performance e incidência de lesões no atleta de natação = : Influence of articular hypermobility in the performance and incidence of injuries in the athlete swimming

Universidade Estadual de Campinas . Faculdade de Educação Física

Knowledge and attitude of parents or caretakers regarding transmissibility os caries disease

Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.

Correlation between metal-ceramic bond strength and coefficient of linear thermal expansion difference

The purpose of this study was to evaluate the metal-ceramic bond strength (MCBS) of 6 metal-ceramic pairs (2 Ni-Cr alloys and 1 Pd-Ag alloy with 2 dental ceramics) and correlate the MCBS values with the differences between the coefficients of linear thermal expansion (CTEs) of the metals and ceramics. Verabond (VB) Ni-Cr-Be alloy, Verabond II (VB2), Ni-Cr alloy, Pors-on 4 (P), Pd-Ag alloy, and IPS (I) and Duceram (D) ceramics were used for the MCBS test and dilatometric test. Forty-eight ceramic rings were built around metallic rods (3.0 mm in diameter and 70.0 mm in length) made from the evaluated alloys. The rods were subsequently embedded in gypsum cast in order to perform a tensile load test, which enabled calculating the CMBS. Five specimens (2.0 mm in diameter and 12.0 mm in length) of each material were made for the dilatometric test. The chromel-alumel thermocouple required for the test was welded into the metal test specimens and inserted into the ceramics. ANOVA and Tukey's test revealed significant differences (p=0.01) for the MCBS test results (MPa), with PI showing higher MCBS (67.72) than the other pairs, which did not present any significant differences. The CTE (10-6 oC-1) differences were: VBI (0.54), VBD (1.33), VB2I (-0.14), VB2D (0.63), PI (1.84) and PD (2.62). Pearson's correlation test (r=0.17) was performed to evaluate of correlation between MCBS and CTE differences. Within the limitations of this study and based on the obtained results, there was no correlation between MCBS and CTE differences for the evaluated metal-ceramic pairs.

Synthesis and biocompatibility of an experimental glass ionomer cement prepared by a non-hydrolytic sol-gel method

The aims of this study were to demonstrate the synthesis of an experimental glass ionomer cement (GIC) by the non-hydrolytic sol-gel method and to evaluate its biocompatibility in comparison to a conventional glass ionomer cement (Vidrion R). Four polyethylene tubes containing the tested cements were implanted in the dorsal region of 15 rats, as follows: GI - experimental GIC and GII - conventional GIC. The external tube walls was considered the control group (CG). The rats were sacrificed 7, 21 and 42 days after implant placement for histopathological analysis. A four-point (I-IV) scoring system was used to graduate the inflammatory reaction. Regarding the experimental GIC sintherization, thermogravimetric and x-ray diffraction analysis demonstrated vitreous material formation at 110oC by the sol-gel method. For biocompatibility test, results showed a moderate chronic inflammatory reaction for GI (III), severe for GII (IV) and mild for CG (II) at 7 days. After 21 days, GI presented a mild reaction (II); GII, moderate (III) and CG, mild (II). At 42 days, GI showed a mild/absent inflammatory reaction (II to I), similar to GII (II to I). CG presented absence of chronic inflammatory reaction (I). It was concluded that the experimental GIC presented mild/absent tissue reaction after 42 days, being biocompatible when tested in the connective tissue of rats.