12 resultados para histopathological

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hippocampal sclerosis (HS) is considered the most frequent neuropathological finding in patients with mesial temporal lobe epilepsy (MTLE). Hippocampal specimens of pharmacoresistant MTLE patients that underwent epilepsy surgery for seizure control reveal the characteristic pattern of segmental neuronal cell loss and concomitant astrogliosis. However, classification issues of hippocampal lesion patterns have been a matter of intense debate. International consensus classification has only recently provided significant progress for comparisons of neurosurgical and clinic-pathological series between different centers. The respective four-tiered classification system of the International League Against Epilepsy subdivides HS into three types and includes a term of gliosis only, no-HS. Future studies will be necessary to investigate whether each of these subtypes of HS may be related to different etiological factors or with postoperative memory and seizure outcome. Molecular studies have provided potential deeper insights into the pathogenesis of HS and MTLE on the basis of epilepsy-surgical hippocampal specimens and corresponding animal models. These include channelopathies, activation of NMDA receptors, and other conditions related to Ca(2+) influx into neurons, the imbalance of Ca(2+)-binding proteins, acquired channelopathies that increase neuronal excitability, paraneoplastic and non-paraneoplastic inflammatory events, and epigenetic regulation promoting or facilitating hippocampal epileptogenesis. Genetic predisposition for HS is clearly suggested by the high incidence of family history in patients with HS, and by familial MTLE with HS. So far, it is clear that HS is multifactorial and there is no individual pathogenic factor either necessary or sufficient to generate this intriguing histopathological condition. The obvious variety of pathogenetic combinations underlying HS may explain the multitude of clinical presentations, different responses to clinical and surgical treatment. We believe that the stratification of neuropathological patterns can help to characterize specific clinic-pathological entities and predict the postsurgical seizure control in an improved fashion.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bisphenol A (BPA) is a chemical that has been investigated for it potential to cause prostate diseases. In this study, pregnant Sprague-Dawley rats were treated with 25 or 250 μg/kg BPA from gestational day (GD) 10 to GD21 with or without concurrent indole-3-carbinol (I3C) feeding. I3C is a phytochemical, and it affords chemoprotection against many types of neoplasia. Male F1 rats from different litters were euthanized on post-natal day (PND) 21 and PND180. BPA-treated groups showed a significant increase in histopathological lesions, but I3C feeding reversed many of these changes, mainly at PND180. Maternal I3C feeding increased prostate epithelial apoptosis in the BPA-treated groups and across age groups. Furthermore, I3C induced partial normalization of the prostate histoarchitecture. The results pointed to a protective effect of maternal I3C feeding during pregnancy in the BPA-exposed male offspring, thereby indicating reduction in the harmful effects of gestational BPA imprinting on the prostate.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In oral and oropharyngeal squamous cell carcinoma (OCSCC and OPSCC) exist an association between clinical and histopathological parameters with cell proliferation, basal lamina, connective tissue degradation and surrounding stroma markers. We evaluated these associations in Chilean patients. A convenience sample of 37 cases of OCSCC (n=16) and OPSCC (n=21) was analyzed clinically (TNM, clinical stage) and histologically (WHO grade of differentiation, pattern of tumor invasion). We assessed the expression of p53, Ki67, HOXA1, HOXB7, type IV collagen (ColIV) and carcinoma-associated fibroblast (α-SMA-positive cells). Additionally we conducted a univariate/bivariate analysis to assess the relationship of these variables with survival rates. Males were mostly affected (56.2% OCSCC, 76.2% OPSCC). Patients were mainly diagnosed at III/IV clinical stages (68.8% OCSCC, 90.5% OPSCC) with a predominantly infiltrative pattern invasion (62.9% OCSCC, 57.1% OPSCC). Significant association between regional lymph nodes (N) and clinical stage with OCSCC-HOXB7 expression (Chi-Square test P < 0.05) was observed. In OPSCC a statistically significant association exists between p53, Ki67 with gender (Chi-Square test P < 0.05). In OCSCC and OPSCC was statistically significant association between ki67 with HOXA1, HOXB7, and between these last two antigens (Pearson's Correlation test P < 0.05). Furthermore OPSCC-p53 showed significant correlation when it was compared with α-SMA (Kendall's Tau-c test P < 0.05). Only OCSCC-pattern invasion and OPSCC-primary tumor (T) pattern resulted associated with survival at the end of the follow up period (Chi-Square Likelihood Ratio, P < 0.05). Clinical, histological and immunohistochemical features are similar to seen in other countries. Cancer proliferation markers were associated strongly from each other. Our sample highlights prognostic value of T and pattern of invasion, but the conclusions may be limited and should be considered with caution (small sample). Many cases were diagnosed in the advanced stages of the disease, which suggests that the diagnosis of OCSCC and OPSCC is made late.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pituitary macroadenomas are rare intracranial tumors. In a few cases, they may present aggressive behavior and invade the sphenoid sinus and nasal cavity, causing unusual symptoms. In this paper, we report an atypical case of pituitary adenoma presenting as a nasal mass. The patient was a 44-year-old woman who had had amenorrhea and galactorrhea for ten months, with associated nasal obstruction, macroglossia and acromegaly. Both growth hormone and prolactin levels were increased. Magnetic resonance imaging showed a large mass originating from the lower surface of the pituitary gland, associated with sella turcica erosion and tumor extension through the sphenoid sinus and nasal cavity. Histopathological analysis demonstrated a chromophobe pituitary adenoma with densely packed rounded epithelial cells, with some atypias and rare mitotic figures. There was no evidence of metastases. Macroadenoma invading the nasal cavity is a rare condition and few similar cases have been reported in the literature. This study contributes towards showing that tumor extension to the sphenoid sinus and nasopharynx needs to be considered and investigated in order to make an early diagnosis when atypical symptoms like nasal obstruction are present.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Mucositis induced by anti-neoplastic drugs is an important, dose-limiting and costly side-effect of cancer therapy. To evaluate the effect of the topical application of S-nitrosoglutathione (GSNO), a nitric oxide donor, on 5-fluorouracil (5-FU)-induced oral mucositis in hamsters. Oral mucositis was induced in male hamsters by two intraperitoneal administrations of 5-FU on the first and second days of the experiment (60 and 40 mg/kg, respectively) followed by mechanical trauma on the fourth day. Animals received saline, HPMC or HPMC/GSNO (0.1, 0.5 or 2.0 mM) 1 h prior to the 5-FU injection and twice a day for 10 or 14 days. Samples of cheek pouches were harvested for: histopathological analysis, TNF-α and IL-1β levels, immunohistochemical staining for iNOS, TNF-α, IL-1β, Ki67 and TGF-β RII and a TUNEL assay. The presence and levels of 39 bacterial taxa were analyzed using the Checkerboard DNA-DNA hybridization method. The profiles of NO released from the HPMC/GSNO formulations were characterized using chemiluminescence. The HPMC/GSNO formulations were found to provide sustained release of NO for more than 4 h at concentration-dependent rates of 14 to 80 nmol/mL/h. Treatment with HPMC/GSNO (0.5 mM) significantly reduced mucosal damage, inflammatory alterations and cell death associated with 5-FU-induced oral mucositis on day 14 but not on day 10. HPMC/GSNO administration also reversed the inhibitory effect of 5-FU on cell proliferation on day 14. In addition, we observed that the chemotherapy significantly increased the levels and/or prevalence of several bacterial species. Topical HPMC/GSNO accelerates mucosal recovery, reduces inflammatory parameters, speeds up re-epithelization and decreases levels of periodontopathic species in mucosal ulcers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pain is a common complaint in women with endometriosis and can be influenced by many variables, including sleep disorders; however, no data are available on the sleep quality of women with endometriosis or on the correlation between sleep quality and pain. The 510 volunteers included in this study were divided into two groups: 257 women with a laparoscopic and histopathological diagnosis of endometriosis and 253 women with no history of endometriosis and no endometriosis-related symptoms. The volunteers answered two questionnaires: the Post-Sleep Inventory to evaluate sleep quality and the International Physical Activity Questionnaire to assess their level of physical activity. Pain was evaluated using a visual analogue scale (VAS) and women were also submitted to a physical examination, during which their pain threshold was assessed at 20 different body sites. Sleep quality was significantly poorer in women with endometriosis compared to women without the disease. The pain threshold was significantly lower in the greater trochanter and abdomen in women with endometriosis when compared to women without the disease; however, there was no difference in VAS pain score between the groups. The higher the VAS pain score, the lower the Post-Sleep Inventory score. Additionally, there was a significant positive correlation between the pain threshold at some body sites and sleep quality. Sleep quality was poorer and the pain threshold at certain body sites was lower in the group of women with endometriosis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Total rectocolectomy and ileal pouch-anal anastomosis is the choice surgical procedure for patients with ulcerative colitis. In cases of Crohn's disease post-operative diagnosis, it can be followed by pouch failure. AIM: To evaluate ileal pouch-anal anastomosis long-term outcome in patients with Crohn's disease. METHODS: Between February 1983 and March 2007, 151 patients were submitted to ileal pouch-anal anastomosis by Campinas State University Colorectal Unit, Campinas, SP, Brazil, 76 had pre-operative ulcerative colitis diagnosis and 11 had post-operative Crohn's disease diagnosis. Crohn's disease diagnosis was made by histopathological biopsies in nine cases, being one in surgical specimen, two cases in rectal stump, small bowel in two cases, ileal pouch in three and in perianal abscess in one of them. The median age was 30.6 years and eight (72.7%) were female. RESULTS: All patients had previous ulcerative colitis diagnosis and in five cases emergency colectomy was done by toxic megacolon. The mean time until of Crohn's disease diagnosis was 30.6 (6-80) months after ileal pouch-anal anastomosis. Ileostomy closure was possible in 10 cases except in one that had ileal pouch fistula, perianal disease and small bowel involvement. In the long-term follow-up, three patients had perineal fistulas and one had also a pouch-vaginal fistula. All of them were submitted to a new ileostomy and one had the pouch excised. Another patient presented pouch-vaginal fistula which was successfully treated by mucosal flap. Three patients had small bowel involvement and three others, pouch involvement. All improved with medical treatment. Presently, the mean follow-up is 76.5 months and all patients are in clinical remission, and four have fecal diversion. The remaining patients have good functional results with 6-10 bowel movements/day. CONCLUSION: Crohn's disease diagnosis after ileal pouch-anal anastomosis for ulcerative colitis may be usual and later complications such fistulas and stenosis are common. However, when left in situ ileal pouch is associated with good function.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A 6 month-old mulatto boy was admitted on account of acute gastroenteritis, malnutrition and dehydration. In the hospital, the child developed septicemia, and temperature reached up to 38.6°C. Despite intensive antibiotic treatment, the patient died 12 days after admission. Necropsy disclosed bilateral bronchopneumonia, bilateral fronto-parietal subarachnoid hemorrhage, and extensive necrosis of the inferior half of both cerebellar hemispheres. On histopathological examination of the necrotic cerebellar cortex, numerous sickled erythrocytes were observed in petechial hemorrhages and, in lesser quantities, inside capillaries. Lesions of the central nervous system in sickle cell anemia most often involve the cerebral cortex, and a single extensive cerebellar infarction as present in this case seems extremely rare. The pathogenetic mechanism of the necrosis is unclear, since thrombosis was not observed either in large blood vessels or in capillaries. Possible contributory factors were the infectious condition (septicemia), fever, and anoxia caused by the extensive bronchopneumonia.