14 resultados para conidial dispersion
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Acid drainage influence on the water and sediment quality was investigated in a coal mining area (southern Brazil). Mine drainage showed pH between 3.2 and 4.6 and elevated concentrations of sulfate, As and metals, of which, Fe, Mn and Zn exceeded the limits for the emission of effluents stated in the Brazilian legislation. Arsenic also exceeded the limit, but only slightly. Groundwater monitoring wells from active mines and tailings piles showed pH interval and chemical concentrations similar to those of mine drainage. However, the river and ground water samples of municipal public water supplies revealed a pH range from 7.2 to 7.5 and low chemical concentrations, although Cd concentration slightly exceeded the limit adopted by Brazilian legislation for groundwater. In general, surface waters showed large pH range (6 to 10.8), and changes caused by acid drainage in the chemical composition of these waters were not very significant. Locally, acid drainage seemed to have dissolved carbonate rocks present in the local stratigraphic sequence, attenuating the dispersion of metals and As. Stream sediments presented anomalies of these elements, which were strongly dependent on the proximity of tailings piles and abandoned mines. We found that precipitation processes in sediments and the dilution of dissolved phases were responsible for the attenuation of the concentrations of the metals and As in the acid drainage and river water mixing zone. In general, a larger influence of mining activities on the chemical composition of the surface waters and sediments was observed when enrichment factors in relation to regional background levels were used.
Resumo:
Often in biomedical research, we deal with continuous (clustered) proportion responses ranging between zero and one quantifying the disease status of the cluster units. Interestingly, the study population might also consist of relatively disease-free as well as highly diseased subjects, contributing to proportion values in the interval [0, 1]. Regression on a variety of parametric densities with support lying in (0, 1), such as beta regression, can assess important covariate effects. However, they are deemed inappropriate due to the presence of zeros and/or ones. To evade this, we introduce a class of general proportion density, and further augment the probabilities of zero and one to this general proportion density, controlling for the clustering. Our approach is Bayesian and presents a computationally convenient framework amenable to available freeware. Bayesian case-deletion influence diagnostics based on q-divergence measures are automatic from the Markov chain Monte Carlo output. The methodology is illustrated using both simulation studies and application to a real dataset from a clinical periodontology study.
Resumo:
American visceral leishmaniasis (AVL) is an emerging disease in the state of São Paulo, Brazil. Its geographical expansion and the increase in the number of human cases has been linked to dispersion of Lutzomyia longipalpis into urban areas. To produce more accurate risk maps we investigated the geographic distribution and routes of expansion of the disease as well as chemotype populations of the vector. A database, containing the annual records of municipalities which had notified human and canine AVL cases as well as the presence of the vector, was compiled. The chemotypes of L. longipalpis populations from municipalities in different regions of São Paulo State were determined by Coupled Gas Chromatography - Mass Spectrometry. From 1997 to June 2014, L. longipalpis has been reported in 166 municipalities, 148 of them in the Western region. A total of 106 municipalities were identified with transmission and 99 were located in the Western region, where all 2,204 autochthonous human cases occurred. Both the vector and the occurrence of human cases have expanded in a South-easterly direction, from the Western to central region, and from there, a further expansion to the North and the South. The (S)-9-methylgermacrene-B population of L. longipalpis is widely distributed in the Western region and the cembrene-1 population is restricted to the Eastern region. The maps in the present study show that there are two distinct epidemiological patterns of AVL in São Paulo State and that the expansion of human and canine AVL cases through the Western region has followed the same dispersion route of only one of the two species of the L. longipalpis complex, (S)-9-methylgermacrene-B. Entomological vigilance based on the routes of dispersion and identification of the chemotype population could be used to identify at-risk areas and consequently define the priorities for control measures.
Resumo:
The interactions of carbon nanotubes with pesticides, such as carbofuran, classical contaminants (e.g., pesticides, polyaromatic hydrocarbons, heavy metals, and dyes) and emerging contaminants, including endocrine disruptors, are critical components of the environmental risks of this important class of carbon-based nanomaterials. In this work, we studied the modulation of acute carbofuran toxicity to the freshwater fish Nile tilapia (Oreochromis niloticus) by nitric acid treated multiwalled carbon nanotubes, termed HNO3-MWCNT. Nitric acid oxidation is a common chemical method employed for the purification, functionalisation and aqueous dispersion of carbon nanotubes. HNO3-MWCNT were not toxic to Nile tilapia at concentrations ranging from 0.1 to 3.0 mg/L for exposure times of up to 96 h. After 24, 48, 72 and 96 h, the LC50 values of carbofuran were 4.0, 3.2, 3.0 and 2.4 mg/mL, respectively. To evaluate the influence of carbofuran-nanotube interactions on ecotoxicity, we exposed the Nile tilapia to different concentrations of carbofuran mixed together with a non-toxic concentration of HNO3-MWCNT (1.0 mg/L). After 24, 48, 72, and 96 h of exposure, the LC50 values of carbofuran plus nanotubes were 3.7, 1.6, 0.7 and 0.5 mg/L, respectively. These results demonstrate that HNO3-MWCNT potentiate the acute toxicity of carbofuran, leading to a more than five-fold increase in the LC50 values. Furthermore, the exposure of Nile tilapia to carbofuran plus nanotubes led to decreases in both oxygen consumption and swimming capacity compared to the control. These findings indicate that carbon nanotubes could act as pesticide carriers affecting fish survival, metabolism and behaviour.
Resumo:
The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.
Resumo:
Morphological caracterization of the seeds and seedlings of six weed especies of the genus Solanum L. The seeds of the genus Solanum are very similar, however, the association of their external characteristics with the anatomical features, such as hilum shape, the texture and the type of the seed coat sculptures, as well as the curved (circulated or coiled) shape of the embryo, are parameters of great importance in the taxonomical identification at the species level. It is are presented the morphological descriptions of the genus Solanum and a more detailed description of each studied species in terms of seed and seedling structures, including illustrations and taxonomical keys for the identification of Solanum aculeatissimum Jacq., S. americanum Mill., S. ciliatum Lam., S. sisymbriifolium Lam., S. sordidum Sendt. e S. viarum Dunal. There are also indications of the common names, the type of reproduction and dispersion, the crops in which the species is considered as a weed and the agricultural seeds in which it is found as a weed seed.
Resumo:
Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: To compare the 2% ibopamine provocative test with the water drinking test as a provocative test for glaucoma. METHODS: Primary open-angle glaucoma patients and normal individuals were selected from CEROF-Universidade Federal de Goiânia UFG, and underwent the 2% ibopamine provocative test and the water drinking test in a randomized fashion, at least 1 week apart. Intraocular pressure (IOP) before and after both tests, Bland-Altman graph, sensitivity and specificity (as mesured by ROC curves) were obtained for both methods. RESULTS: Forty-seven eyes from 25 patients were included (27 eyes from 15 glaucoma patients and 20 eyes from 10 normal individuals), with a mean age of 54.2 ± 12.7 years. The mean MD of glaucoma patients was -2.8 ± 2.11 dB. There was no statistically difference in the baseline IOP (p=0.8) comparing glaucoma patients, but positive after the provocative tests (p=0.03), and in the IOP variation (4.4 ± 1.3 mmHg for ibopamine and 3.2 ± 2.2 mmHg for water drinking test, p=0.01). There was no difference in all studied parameters for normal individuals. The Bland-Altman graph showed high dispersion comparing both methods. The areas under the ROC curve were 0.987 for the ibopamine provocative test, and 0.807 for the water-drinking test. CONCLUSION: In this selected subgroup of glaucoma patients with early visual field defect, the ibopamine provocative test has shown better sensitivity/specificity than the water drinking test.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física