Iis--integrated Interactome System: A Web-based Platform For The Annotation, Analysis And Visualization Of Protein-metabolite-gene-drug Interactions By Integrating A Variety Of Data Sources And Tools.

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Identification Of Corynebacterium Spp. Isolated From Bovine Intramammary Infections By Matrix-assisted Laser Desorption Ionization-time Of Flight Mass Spectrometry.

Corynebacterium species (spp.) are among the most frequently isolated pathogens associated with subclinical mastitis in dairy cows. However, simple, fast, and reliable methods for the identification of species of the genus Corynebacterium are not currently available. This study aimed to evaluate the usefulness of matrix-assisted laser desorption ionization/mass spectrometry (MALDI-TOF MS) for identifying Corynebacterium spp. isolated from the mammary glands of dairy cows. Corynebacterium spp. were isolated from milk samples via microbiological culture (n=180) and were analyzed by MALDI-TOF MS and 16S rRNA gene sequencing. Using MALDI-TOF MS methodology, 161 Corynebacterium spp. isolates (89.4%) were correctly identified at the species level, whereas 12 isolates (6.7%) were identified at the genus level. Most isolates that were identified at the species level with 16 S rRNA gene sequencing were identified as Corynebacterium bovis (n=156; 86.7%) were also identified as C. bovis with MALDI-TOF MS. Five Corynebacterium spp. isolates (2.8%) were not correctly identified at the species level with MALDI-TOF MS and 2 isolates (1.1%) were considered unidentified because despite having MALDI-TOF MS scores >2, only the genus level was correctly identified. Therefore, MALDI-TOF MS could serve as an alternative method for species-level diagnoses of bovine intramammary infections caused by Corynebacterium spp.

Remediation Of 17-α-ethinylestradiol Aqueous Solution By Photocatalysis And Electrochemically-assisted Photocatalysis Using Tio2 And Tio2/wo3 Electrodes Irradiated By A Solar Simulator.

TiO2 and TiO2/WO3 electrodes, irradiated by a solar simulator in configurations for heterogeneous photocatalysis (HP) and electrochemically-assisted HP (EHP), were used to remediate aqueous solutions containing 10 mg L(-1) (34 μmol L(-1)) of 17-α-ethinylestradiol (EE2), active component of most oral contraceptives. The photocatalysts consisted of 4.5 μm thick porous films of TiO2 and TiO2/WO3 (molar ratio W/Ti of 12%) deposited on transparent electrodes from aqueous suspensions of TiO2 particles and WO3 precursors, followed by thermal treatment at 450 (°)C. First, an energy diagram was organized with photoelectrochemical and UV-Vis absorption spectroscopy data and revealed that EE2 could be directly oxidized by the photogenerated holes at the semiconductor surfaces, considering the relative HOMO level for EE2 and the semiconductor valence band edges. Also, for the irradiated hybrid photocatalyst, electrons in TiO2 should be transferred to WO3 conduction band, while holes move toward TiO2 valence band, improving charge separation. The remediated EE2 solutions were analyzed by fluorescence, HPLC and total organic carbon measurements. As expected from the energy diagram, both photocatalysts promoted the EE2 oxidation in HP configuration; after 4 h, the EE2 concentration decayed to 6.2 mg L(-1) (35% of EE2 removal) with irradiated TiO2 while TiO2/WO3 electrode resulted in 45% EE2 removal. A higher performance was achieved in EHP systems, when a Pt wire was introduced as a counter-electrode and the photoelectrodes were biased at +0.7 V; then, the EE2 removal corresponded to 48 and 54% for the TiO2 and TiO2/WO3, respectively. The hybrid TiO2/WO3, when compared to TiO2 electrode, exhibited enhanced sunlight harvesting and improved separation of photogenerated charge carriers, resulting in higher performance for removing this contaminant of emerging concern from aqueous solution.

Refractive Error In School Children In Campinas, Brazil.

77

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Supercritical Carbon Dioxide Extraction Of Capsaicinoids From Malagueta Pepper (capsicum Frutescens L.) Assisted By Ultrasound.

Extracts from malagueta pepper (Capsicum frutescens L.) were obtained using supercritical fluid extraction (SFE) assisted by ultrasound, with carbon dioxide as solvent at 15MPa and 40°C. The SFE global yield increased up to 77% when ultrasound waves were applied, and the best condition of ultrasound-assisted extraction was ultrasound power of 360W applied during 60min. Four capsaicinoids were identified in the extracts and quantified by high performance liquid chromatography. The use of ultrasonic waves did not influence significantly the capsaicinoid profiles and the phenolic content of the extracts. However, ultrasound has enhanced the SFE rate. A model based on the broken and intact cell concept was adequate to represent the extraction kinetics and estimate the mass transfer coefficients, which were increased with ultrasound. Images obtained by field emission scanning electron microscopy showed that the action of ultrasonic waves did not cause cracks on the cell wall surface. On the other hand, ultrasound promoted disturbances in the vegetable matrix, leading to the release of extractable material on the solid surface. The effects of ultrasound were more significant on SFE from larger solid particles.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

A Metabolomic Protocol For Plant Systematics By Matrix-assisted Laser-desorption/ionization Time-of Flight Mass Spectrometry.

Matrix-assisted laser desorption/ionization time-of flight mass spectrometry (MALDI-TOF MS) has been widely used for the identification and classification of microorganisms based on their proteomic fingerprints. However, the use of MALDI-TOF MS in plant research has been very limited. In the present study, a first protocol is proposed for metabolic fingerprinting by MALDI-TOF MS using three different MALDI matrices with subsequent multivariate data analysis by in-house algorithms implemented in the R environment for the taxonomic classification of plants from different genera, families and orders. By merging the data acquired with different matrices, different ionization modes and using careful algorithms and parameter selection, we demonstrate that a close taxonomic classification can be achieved based on plant metabolic fingerprints, with 92% similarity to the taxonomic classifications found in literature. The present work therefore highlights the great potential of applying MALDI-TOF MS for the taxonomic classification of plants and, furthermore, provides a preliminary foundation for future research.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Proposição de um método de análise de movimentos de jogadores de tênis de campo a partir de vídeos televisivos = : Proposition of a method for tennis players motion analysis on broadcast videos

Universidade Estadual de Campinas . Faculdade de Educação Física

Rastreamento automatico de trajetorias de jogadores de futebol por videogrametria : validação do metodo e analise dos resultados

Universidade Estadual de Campinas . Faculdade de Educação Física