Chitosan Nanoparticles Loaded The Herbicide Paraquat: The Influence Of The Aquatic Humic Substances On The Colloidal Stability And Toxicity.

Polymeric nanoparticles have been developed for several applications, among them as carrier system of pesticides. However, few studies have investigated the fate of these materials in the environment in relation to colloidal stability and toxicity. In nature, humic substances are the main agents responsible for complexation with metals and organic compounds, as well as responsible for the dynamics of these nanoparticles in aquatic and terrestrial environments. In this context, the evaluation of the influence of aquatic humic substances (AHS) on the colloidal stability and toxicity of polymeric nanoparticles of chitosan/tripolyphosphate with or without paraquat was performed. In this study, the nanoparticles were prepared by the ionic gelation method and characterized by size distribution measurements (DLS and NTA), zeta potential, infrared and fluorescence spectroscopy. Allium cepa genotoxicity studies and ecotoxicity assays with the alga Pseudokirchneriella subcapitata were used to investigate the effect of aquatic humic substances (AHS) on the toxicity of this delivery system. No changes were observed in the physical-chemical stability of the nanoparticles due to the presence of AHS using DLS and NTA techniques. However some evidence of interaction between the nanoparticles and AHS was observed by infrared and fluorescence spectroscopies. The ecotoxicity and genotoxicity assays showed that humic substances can decrease the toxic effects of nanoparticles containing paraquat. These results are interesting because they are important for understanding the interaction of these nanostructured carrier systems with species present in aquatic ecosystems such as humic substances, and in this way, opening new perspectives for studies on the dynamics of these carrier systems in the ecosystem.

Yellowing And Bleaching Of Grey Hair Caused By Photo And Thermal Degradation.

Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.

The Effect Of Celastrol, A Triterpene With Antitumorigenic Activity, On Conformational And Functional Aspects Of The Human 90kda Heat Shock Protein Hsp90α, A Chaperone Implicated In The Stabilization Of The Tumor Phenotype.

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Selection And Validation Of Reference Genes For Functional Studies In The Calliphoridae Family.

The genera Cochliomyia and Chrysomya contain both obligate and saprophagous flies, which allows the comparison of different feeding habits between closely related species. Among the different strategies for comparing these habits is the use of qPCR to investigate the expression levels of candidate genes involved in feeding behavior. To ensure an accurate measure of the levels of gene expression, it is necessary to normalize the amount of the target gene with the amount of a reference gene having a stable expression across the compared species. Since there is no universal gene that can be used as a reference in functional studies, candidate genes for qPCR data normalization were selected and validated in three Calliphoridae (Diptera) species, Cochliomyia hominivorax Coquerel, Cochliomyia macellaria Fabricius, and Chrysomya albiceps Wiedemann . The expression stability of six genes ( Actin, Gapdh, Rp49, Rps17, α -tubulin, and GstD1) was evaluated among species within the same life stage and between life stages within each species. The expression levels of Actin, Gapdh, and Rp49 were the most stable among the selected genes. These genes can be used as reliable reference genes for functional studies in Calliphoridae using similar experimental settings.

Development And Characterization Of A Cationic Lipid Nanocarrier As Non-viral Vector For Gene Therapy.

The aim of the present work was to produce a cationic solid lipid nanoparticle (SLN) as non-viral vector for protein delivery. Cationic SLN were produced by double emulsion method, composed of softisan(®) 100, cetyltrimethylammonium bromide (CTAB), Tween(®) 80, Span(®) 80, glycerol and lipoid(®) S75 loading insulin as model protein. The formulation was characterized in terms of mean hydrodynamic diameter (z-ave), polydispersity index (PI), zeta potential (ZP), stability during storage time, stability after lyophilization, effect of toxicity and transfection ability in HeLa cells, in vitro release profile and morphology. SLN were stable for 30days and showed minimal changes in their physicochemical properties after lyophilization. The particles exhibited a relatively slow release, spherical morphology and were able to transfect HeLa cells, but toxicity remained an obstacle. Results suggest that SLN are nevertheless promising for delivery of proteins or nucleic acids for gene therapy.

Engineered Nanoparticles And Organic Matter: A Review Of The State-of-the-art.

Growth in the development and production of engineered nanoparticles (ENPs) in recent years has increased the potential for interactions of these nanomaterials with aquatic and terrestrial environments. Carefully designed studies are therefore required in order to understand the fate, transport, stability, and toxicity of nanoparticles. Natural organic matter (NOM), such as the humic substances found in water, sediment, and soil, is one of the substances capable of interacting with ENPs. This review presents the findings of studies of the interaction of ENPs and NOM, and the possible effects on nanoparticle stability and the toxicity of these materials in the environment. In addition, ENPs and NOM are utilized for many different purposes, including the removal of metals and organic compounds from effluents, and the development of new electronic sensors and other devices for the detection of active substances. Discussion is therefore provided of some of the ways in which NOM can be used in the production of nanoparticles. Although there has been an increase in the number of studies in this area, further progress is needed to improve understanding of the dynamic interactions between ENPs and NOM.

Ethanol Modulates The Synthesis And Catabolism Of Retinoic Acid In The Rat Prostate.

All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeito das sessões de familiarização sobre o pico de torque e taxa de desenvolvimento de torque : comparações entre jovens, meia idade e idosos = Effect of familiarization sessions on peak torque and rate of torque development : comparisons among young, middle age and elderly

Universidade Estadual de Campinas, Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física