31 resultados para Processo tecnológico

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Malaria is still one of the major diseases in the world, causing physical and economic problems in tropical regions. Artemisinin (Qinghaosu), a natural compound identified in Artemisia annua L. , is an effective drug mainly against cerebral malaria. The action of this drug is immediate and parasitaemia in the treatment of drug-resistant malaria is rapidily reduced, justifying the industrial production of artemisinin. This article focuses on the industrial production of this potent antimalarial drug, including strategies for enhancing yield using inexpensive and easy steps.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper discusses the results obtained with homogeneous catalytic ozonation [Mn (II) and Cu (II)] in phenol degradation. The reduction of total phenols and total organic carbon (TOC) and the ozone consumption were evaluated. The efficiency in phenol degradation (total phenol removal) at pH 3, with the catalytic process (Mn (II)), increased from 37% to 55% while the TOC removal increased from 4 to 63% in a seven-minute treatment. The ozonation process efficiency at pH 10 was 43% and 39% for phenol and TOC removal, respectively. The presence of both metallic ions (Mn2+ and Cu+2) in the ozonation process resulted in a positive effect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study had as objective the evaluation of mechanical damages occurred in banana Nanicão during the improvement process, packing and distribution, identifying the probable critical points. The mechanical damages caused by transport, first cleaning; cleanness and sorting; preservation in the packing, transport, and mature were evaluated. The studied packing had been: torito wooden packing (18 kg), wood type ½ box, (13 kg) and cardboard (18 kg). The stage of preservation and transport of the fruits to the distribution center duplicated the light defects and quintupled the serious defects, causing rottenness after the acclimatization. The cardboard packing did not support the piling up and presented deformations, that resulted in the kneading the fruits of the inferior packing, causing a significant increase of the serious defects. The fruits conditioned in the involved packing of plastic bubble had presented an inferior number of serious damages when compared with the others packing, without the plastic.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biodegradability of animal wastes production was evaluated through a simplified methodology that allowed the verification of the applicability of anaerobic processes. The experiments were performed in bath reactors, with granular sludge of three origins: UASB reactor treating dairy effluent, UASB reactor treating swine effluent and UASB reactor treating effluent of slaughterhouse of poultry. The experiments (1) - dairy effluent and poultry slaughterhouse non-adapted sludge; (2) -swine effluent and poultry slaughterhouse non-adapted sludge; (3) - dairy effluent and poultry slaughterhouse adapted sludge; (4) - swine effluent and poultry slaughterhouse adapted sludge; (5) - dairy effluent and dairy sludge, and (6) - swine effluent and swine sludge were performed in Incubator Shaker, at a temperature of 35 °C, under agitation at a 150 rpm, for 5 minutes, every 1 hour. A substrat:biomass relationship of 0.5 was used. Kinetic models of Monod, Zero Order, First and Second Order were tested and it was verified that the First Order model provided the best adjustment. The apparent First Order kinetic parameter (k1) was estimated for the experiments 1; 2; 3; 4; 5, and 6, as 2.51 x 10-2; 2.49 x 10-2; 1.90 x 10-2; 3.09 x 10-2; 2.54 x 10-2; 4.09 x 10-2 h-1, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cardboard packing for horticultural products has as main function to protect them. The design of a cardboard packing request the knowledge of the bending stiffens which is depending on the modulus of elasticity. The objective of this work was to calculate the cardboard modulus of elasticity from data obtained in laboratory using physical characterization test, with different methods, and comparing the results with the values obtained experimentally. Ten samples of each cardboard selected for this study were tested in the paper fabrication direction and in its transverse direction. The papers liner and medium resistance to the traction, used to calculate the bending stiffness, was determined in a universal machine test. To obtaining of the bending stiffens the four points test was accomplished. Expressive variations among the methods from which the modulus of elasticity is obtained were observed and that influence the bending stiffness of the structure. The stiffness values obtained experimentally were always greater than the values obtained from analytical method. This difference can be attributed to two factors, the production processes that assurance a larger rigidity than the components separately and the addition of the adhesive layer that is not taken in consideration in the analytic calculations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Edible mushroom are highly perishable foods. Drying is an alternative to provide safe storage. In this work, the effects of some drying parameters on the quality of Shiitake mushroom were investigated: geometry of the raw material (whole and sliced), drying temperature (50 °C and 70 ºC) and final moisture content (5% and 15% wb). Experimental kinetics of drying was built and color and texture analyses were done in fresh and in rehydrated dried product. The effect of parameters was evaluated by analysis of variance and test of multiple comparisons. Drying kinetics showed that drying happened in falling-rate period and sliced mushroom dried at 70 ºC required lesser drying time than other treatments. Mushroom dried at 70 ºC showed less darkening. Drying time affected mushroom quality, evaluated by great hardness, gummosis and darkening.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work aimed to create a methodology to evaluate the pulverization process with the use of quality tools. It was listed the primary factors, secondary factors, tertiary factors and, with the check list tool support, the list was elaborated. It was evaluated the factors labor, agriculture machine, material and method of 32 pulverization process before pesticide application, in that each factor received a punctuation, having as total sum of 750 points. The medium punctuation to the factors labor, agriculture machine, material and method was 78; 211; 49; 20 and 94 points, respectively. The sum of the factors points for the 32 processes, the minimum value found was 230 and maximum was 620 points. With the proposed methodology, can be identify which common causes of the processes can affect its result.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Development of processing technology and equipments requires new methods and better quality of the processed product. In the continuous drying process, utilization of equipments that promotes an increment in the transfer coefficients becomes of the major interest. The use of vibrational energy has been recommended to the dispersed materials. Such method is based on the use of vibrational energy applied to disperse media. Thus, a literature review on the mass transfer and drying in vibro-fluidized beds was carried out, showing experimental results and mathematical modeling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física