Uso de perfis cromatográficos de voláteis de cafés arábicas torrados para a diferenciação das amostras segundo o sabor, o aroma e a qualidade global da bebida

In this work, the volatile chromatographic profiles of roasted Arabica coffees, previously analyzed for their sensorial attributes, were explored by principal component analysis. The volatile extraction technique used was the solid phase microextraction. The correlation optimized warping algorithm was used to align the gas chromatographic profiles. Fifty four compounds were found to be related to the sensorial attributes investigated. The volatiles pyrrole, 1-methyl-pyrrole, cyclopentanone, dihydro-2-methyl-3-furanone, furfural, 2-ethyl-5-methyl-pyrazine, 2-etenyl-n-methyl-pyrazine, 5-methyl-2-propionyl-furan compounds were important for the differentiation of coffee beverage according to the flavour, cleanliness and overall quality. Two figures of merit, sensitivity and specificity (or selectivity), were used to interpret the sensory attributes studied.

Perfis temporais NDVI MODIS, na cana-soca, de maturação tardia

This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.

Síndrome de Rett: estudo retrospectivo e prospectivo de 28 pacientes

From November 1982 to May 1999, 28 children with Rett syndrome were followed-up for a medium period of 6 years and 2 months. Regression of developmental milestones started at the age between 5 and 20 months. Nineteen cases of typical Rett syndrome had uneventful pre and perinatal periods, loss of previously acquired purposeful hand skills, mental and motor regression and developed hand stereotypies; sixteen had head growth deceleration and 12 gait apraxia. Nine patients were atypical cases, 2 formes frustres, 2 congenital, 3 with early seizure onset, 1 preserved speech and 1 male. Epilepsy was present in 21 patients, predominantly partial seizures and the drug of choise was carbamazepine (15 patients). In the initial evaluation most patients were distributed on Stages II and III and on follow-up on Stages III and IV. Three children died.

Modelo dinâmico de simulação e otimização da força normal de reação do solo para um mecanismo de corte basal

The physical model was based on the method of Newton-Euler. The model was developed by using the scientific computer program Mathematica®. Several simulations where tried varying the progress speeds (0.69; 1.12; 1.48; 1.82 and 2.12 m s-1); soil profiles (sinoidal, ascending and descending ramp) and height of the profile (0.025 and 0.05 m) to obtain the normal force of soil reaction. After the initial simulations, the mechanism was optimized using the scientific computer program Matlab® having as criterion (function-objective) the minimization of the normal force of reaction of the profile (FN). The project variables were the lengths of the bars (L1y, L2, l3 and L4), height of the operation (L7), the initial length of the spring (Lmo) and the elastic constant of the spring (k t). The lack of robustness of the mechanism in relation to the variable height of the operation was outlined by using a spring with low rigidity and large length. The results demonstrated that the mechanism optimized showed better flotation performance in relation to the initial mechanism.

Características espectrais da soja ao longo do ciclo vegetativo com imagens landsat 5/TM em área agrícola no oeste do Paraná

The objective of this study was to analyze changes in the spectral behavior of the soybean crop through spectral profiles of the vegetation indexes NDVI and GVI, expressed by different physical values such as apparent bi-directional reflectance factor (BRF), surface BRF, and normalized BRF derived from images of the Landsat 5/TM. A soybean area located in Cascavel, Paraná, was monitored by using five images of Landsat 5/TM during the 2004/2005 harvesting season. The images were submitted to radiometric transformation, atmospheric correction and normalization, determining physical values of apparent BRF, surface BRF and normalized BRF. NDVI and GVI images were generated in order to distinguish the soybean biomass spectral response. The treatments showed different results for apparent, surface and normalized BRF. Through the profiles of average NDVI and GVI, it was possible to monitor the entire soybean cycle, characterizing its development. It was also observed that the data from normalized BRF negatively affected the spectral curve of soybean crop, mainly, during the phase of vegetative growth, in the 12-9-2004 image.

TEORIA SINTÁTICA: DE UMA PERSPECTIVA DE -ISMOS PARA UMAPERSPECTIVA DE PROGRAMAS

This paper tries to show that the developments in linguistic sciences are better viewed as stages in a single research program, rather than different ideological -isms. The first part contains an overview of the structuralistas' beliefs about the universality and equivalence of human languages, and their search for syntactic universals. In the second part, we will see that the generative program, in its turn, tries to answer why language is a universal faculty in the human species and addresses questions about its form, its development and its use. In the second part, we will see that the paper gives a brief glimpse of the tentative answers the program has been giving to each of these issues.

Adaptação de protocolos invasivos e não invasivos para avaliações aeróbias e anaeróbias específicas ao basquetebol feminino

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Phenotypic variability in a family with x-linked adrenoleukodystrophy caused by the p.Trp132Ter mutation

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Are skeletally mature female rats a suitable model to study osteoporosis?

OBJECTIVE: To analyze if female Wistar rats at 56 weeks of age are a suitable model to study osteoporosis. MATERIALS AND METHODS: Female rats with 6 and 36 weeks of age (n = 8 per group) were kept over a 20-week period and fed a diet for mature rodents complete in terms of Ca, phosphorous, and vitamin D. Excised femurs were measured for bone mass using dual-energy x-ray absorptiometry, morphometry, and biomechanical properties. The following serum mar-kers of bone metabolism were analyzed: parathyroid hormone (PTH), osteocalcin (OC), osteoprotegerin (OPG), receptor activator of nuclear factor Κappa B ligand (RANKL), C-terminal peptides of type I collagen (CTX-I), total calcium, and alkaline phosphatase (ALP) activity. RESULTS: Rats at 56 weeks of age showed important bone metabolism differences when compared with the younger group, such as, highest diaphysis energy to failure, lowest levels of OC, CTX-I, and ALP, and elevated PTH, even with adequate dietary Ca. CONCLUSION: Rats at 26-week-old rats may be too young to study age-related bone loss, whereas the 56-week-old rats may be good models to represent the early stages of age-related changes in bone metabolism.

A abordagem centrada na pessoa e a psicologia do esporte : vivência de um psicólogo com jogadores e a comissão técnica de uma equipe durante os períodos de preparação e disputa da Copa São Paulo de Futebol Júnior

Universidade Estadual de Campinas . Faculdade de Educação Física

Formação empirica na educação superior : um estudo de caso na Faculdade de Educação Fisica da Unicamp

Universidade Estadual de Campinas. Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudos dos desniveis e desvios posturais nas atletas que praticam a modalidade esportiva voleibol

Universidade Estadual de Campinas. Faculdade de Educação Física