Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação da eficiência do processo de ozonização e ozonização catalítica (Mn II e Cu II) na degradação de fenol

This paper discusses the results obtained with homogeneous catalytic ozonation [Mn (II) and Cu (II)] in phenol degradation. The reduction of total phenols and total organic carbon (TOC) and the ozone consumption were evaluated. The efficiency in phenol degradation (total phenol removal) at pH 3, with the catalytic process (Mn (II)), increased from 37% to 55% while the TOC removal increased from 4 to 63% in a seven-minute treatment. The ozonation process efficiency at pH 10 was 43% and 39% for phenol and TOC removal, respectively. The presence of both metallic ions (Mn2+ and Cu+2) in the ozonation process resulted in a positive effect.

Otimização do processo de extração e isolamento do antimalárico artemisinina a partir de Artemisia annua L.

Malaria is still one of the major diseases in the world, causing physical and economic problems in tropical regions. Artemisinin (Qinghaosu), a natural compound identified in Artemisia annua L. , is an effective drug mainly against cerebral malaria. The action of this drug is immediate and parasitaemia in the treatment of drug-resistant malaria is rapidily reduced, justifying the industrial production of artemisinin. This article focuses on the industrial production of this potent antimalarial drug, including strategies for enhancing yield using inexpensive and easy steps.

Sistema de monitoramento de perdas visíveis de cana-de-açúcar em colhedora de cana picada

In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.

Influência do processo de secagem na qualidade do cogumelo shiitake

Edible mushroom are highly perishable foods. Drying is an alternative to provide safe storage. In this work, the effects of some drying parameters on the quality of Shiitake mushroom were investigated: geometry of the raw material (whole and sliced), drying temperature (50 °C and 70 ºC) and final moisture content (5% and 15% wb). Experimental kinetics of drying was built and color and texture analyses were done in fresh and in rehydrated dried product. The effect of parameters was evaluated by analysis of variance and test of multiple comparisons. Drying kinetics showed that drying happened in falling-rate period and sliced mushroom dried at 70 ºC required lesser drying time than other treatments. Mushroom dried at 70 ºC showed less darkening. Drying time affected mushroom quality, evaluated by great hardness, gummosis and darkening.

Proposta metodológica utilizando ferramentas de qualidade na avaliação do processo de pulverização

The present work aimed to create a methodology to evaluate the pulverization process with the use of quality tools. It was listed the primary factors, secondary factors, tertiary factors and, with the check list tool support, the list was elaborated. It was evaluated the factors labor, agriculture machine, material and method of 32 pulverization process before pesticide application, in that each factor received a punctuation, having as total sum of 750 points. The medium punctuation to the factors labor, agriculture machine, material and method was 78; 211; 49; 20 and 94 points, respectively. The sum of the factors points for the 32 processes, the minimum value found was 230 and maximum was 620 points. With the proposed methodology, can be identify which common causes of the processes can affect its result.

Eficiência do processo de recobrimento de sementes de brócolos recobertas com polímero em leito de jorro

Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.

Variáveis objetivas e subjetivas para monitoramento de diferentes ciclos de temporada em jogadores de basquete

The present study aimed to evaluate, compare and relate load and training tiredness during a periodization cycle in basketball players. Eight professional male athletes aged 21.9 ± 3.4 years, all of whom participated in the São Paulo basketball championship, special division, took part in this study. The macrocycle analyzed encompassed 19 weeks divided into the following periods: Preparatory, Competitive I, and Competitive II (having 4, 6, and 9 weeks, respectively). The authors daily evaluated the athletes on subjective perception of tiredness and training load and monitored the athletes' upper limb power by quantifying their ability to throw a medicine ball. Athletes presented less fatigue (p <0.005) in the Preparatory period (13.71 ± 1.30) compared with the Competitive I (14.68 ± 1.51) and Competitive II (14.63 ± 1.22) periods. Their ability to throw the medicine ball decreased (p <0.005) in the Competitive period II (3.59 ± 0.30) compared with the Preparatory (3.80 ± 0.36) and Competitive I (3.86 ± 0.26) periods. Their monotony decreased (p <0.001) in the Competitive period II (1.18 ± 0.43) compared with the Preparatory (2.50 ± 2.01) and Competitive I (2.10 ± 1.61) periods. The results revealed the effectiveness of monitoring load and tiredness of athletes by means of the proposed method to assist in training organization during a macrocycle.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

O papel da interação no processo de ensino-aprendizagem de português para alunos surdos em uma escola inclusiva

In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

As aulas de educação fisica escolar : uma analise do processo inclusivo

Universidade Estadual de Campinas. Faculdade de Educação Física

Pedagogia do esporte : identificação, discussão e aplicação de procedimentos pedagogicos no processo de ensino-vivencia aprendizagem da modalidade basquetebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise do processo de rastreamento automatico de jogadores em esportes coletivos

Universidade Estadual de Campinas . Faculdade de Educação Física

As manifestações da emoção vivida no processo de aprendizagem da educação fisica escolar : totalidade ininterrupta de troca e construção de experiencias humanas

Universidade Estadual de Campinas . Faculdade de Educação Física