11 resultados para Internacional mobility coordinator and MIPE .

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fibrodysplasia ossificans progressiva is a rare genetic disease characterized by widespread soft tissue ossification and congenital stigmata of the extremities. We report on a male child followed for ten years since the age of 3 years and 9 months, when the diagnosis was made. He was born with bilateral hypoplasic hallux valgus and ventricular septal defect, corrected by transsternal approach when 32 months old. Restriction of neck mobility followed and foci of ectopic ossification appeared. Four crises of disease exacerbation were treated with oral prednisone and/or other antiinflammatory drugs. Sodium etidronate 5 to 10 mg/kg/day was prescribed intermittently during about six years but was discontinued due to osteopenia. The disease course has been relentless, with severe movement restriction including the chest wall. A review showed few similar case reports in the Brazilian literature. We revisit the criteria for diagnosis and the essentials of management and treatment.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

During the last ten years, graphene oxide has been explored in many applications due to its remarkable electroconductivity, thermal properties and mobility of charge carriers, among other properties. As discussed in this review, the literature suggests that a total characterization of graphene oxide must be conducted because oxidation debris (synthesis impurities) present in the graphene oxides could act as a graphene oxide surfactant, stabilizing aqueous dispersions. It is also important to note that the structure models of graphene oxide need to be revisited because of significant implications for its chemical composition and its direct covalent functionalization. Another aspect that is discussed is the need to consider graphene oxide surface chemistry. The hemolysis assay is recommended as a reliable test for the preliminary assessment of graphene oxide toxicity, biocompatibility and cell membrane interaction. More recently, graphene oxide has been extensively explored for drug delivery applications. An important increase in research efforts in this emerging field is clearly represented by the hundreds of related publications per year, including some reviews. Many studies have been performed to explore the graphene oxide properties that enable it to deliver more than one activity simultaneously and to combine multidrug systems with photothermal therapy, indicating that graphene oxide is an attractive tool to overcome hurdles in cancer therapies. Some strategic aspects of the application of these materials in cancer treatment are also discussed. In vitro studies have indicated that graphene oxide can also promote stem cell adhesion, growth and differentiation, and this review discusses the recent and pertinent findings regarding graphene oxide as a valuable nanomaterial for stem cell research in medicine. The protein corona is a key concept in nanomedicine and nanotoxicology because it provides a biomolecular identity for nanomaterials in a biological environment. Understanding protein corona-nanomaterial interactions and their influence on cellular responses is a challenging task at the nanobiointerface. New aspects and developments in this area are discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física