18 resultados para Initial stages
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Chemometric activities in Brazil are described according to three phases: before the existence of microcomputers in the 1970s, through the initial stages of microcomputer use in the 1980s and during the years of extensive microcomputer applications of the ´90s and into this century. Pioneering activities in both the university and industry are emphasized. Active research areas in chemometrics are cited including experimental design, pattern recognition and classification, curve resolution for complex systems and multivariate calibration. New trends in chemometrics, especially higher order methods for treating data, are emphasized.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.
Resumo:
Although MRI is utilized for planning the resection of soft-tissue tumors, it is not always capable of differentiating benign from malignant lesions. The risk of local recurrence of soft-tissue sarcomas is increased when biopsies are performed before resection and by inadequate resections. PET associated with computed tomography using fluorodeoxyglucose labeled with fluorine-18 ((18)F-FDG PET/CT) may help differentiate between benign and malignant tumors, thus avoiding inadequate resections and making prior biopsies unnecessary. The purpose of this study was to evaluate the usefulness of (18)F-FDG PET/CT in differentiating benign from malignant solid soft-tissue lesions. Patients with solid lesions of the limbs or abdominal wall detected by MRI were submitted to (18)F-FDG PET/CT. The maximum standardized uptake value (SUVmax) cutoff was determined to differentiate malignant from benign tumors. Regardless of the (18)F-FDG PET/CT results all patients underwent biopsy and surgery. MRI was performed in 54 patients, and 10 patients were excluded because of purely lipomatose or cystic lesions. (18)F-FDG PET/CT was performed in the remaining 44 patients. Histopathology revealed 26 (59%) benign and 18 (41%) malignant soft-tissue lesions. A significant difference in SUVmax was observed between benign and malignant soft-tissue lesions. The SUVmax cutoff of 3.0 differentiated malignant from benign lesions with 100% sensitivity, 83.3% specificity, 89.6% accuracy, 78.3% positive predictive value, and 100% negative predictive value. (18)F-FDG PET/CT seems to be able to differentiate benign from malignant soft-tissue lesions with good accuracy and very high negative predictive value. Incorporating (18)F-FDG PET/CT into the diagnostic algorithm of these patients may prevent inadequate resections and unnecessary biopsies.
Resumo:
The objectives of the study were to evaluate the performance of sentinel lymph node biopsy (SLNB) in detecting occult metastases in papillary thyroid carcinoma (PTC) and to correlate their presence to tumor and patient characteristics. Twenty-three clinically node-negative PTC patients (21 females, mean age 48.4 years) were prospectively enrolled. Patients were submitted to sentinel lymph node (SLN) lymphoscintigraphy prior to total thyroidectomy. Ultrasound-guided peritumoral injections of (99m)Tc-phytate (7.4 MBq) were performed. Cervical single-photon emission computed tomography and computed tomography (SPECT/CT) images were acquired 15 min after radiotracer injection and 2 h prior to surgery. Intra-operatively, SLNs were located with a gamma probe and removed along with non-SLNs located in the same neck compartment. Papillary thyroid carcinoma, SLNs and non-SLNs were submitted to histopathology analysis. Sentinel lymph nodes were located in levels: II in 34.7 % of patients; III in 26 %; IV in 30.4 %; V in 4.3 %; VI in 82.6 % and VII in 4.3 %. Metastases in the SLN were noted in seven patients (30.4 %), in non-SLN in three patients (13.1 %), and in the lateral compartments in 20 % of patients. There were significant associations between lymph node (LN) metastases and the presence of angio-lymphatic invasion (p = 0.04), extra-thyroid extension (p = 0.03) and tumor size (p = 0.003). No correlations were noted among LN metastases and patient age, gender, stimulated thyroglobulin levels, positive surgical margins, aggressive histology and multifocal lesions. Sentinel lymph node biopsy can detect occult metastases in PTC. The risk of a metastatic SLN was associated with extra-thyroid extension, larger tumors and angio-lymphatic invasion. This may help guide future neck dissection, patient surveillance and radioiodine therapy doses.
Resumo:
Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.
Resumo:
To present a case report of a metastasis from cervical cancer to the maxilla, which was misdiagnosed as periapical disease and to caution clinicians that metastases could have a disguised clinical presentation that must be taken into account in the differential diagnosis of periapical disease in oncologic patients. Although metastatic tumours of the jaws are uncommon, they may mimic benign inflammatory processes and reactive lesions. The ability of metastatic lesions to mimic periapical disease is discussed and a brief review of the literature is presented, emphasizing the importance of correct diagnosis to prevent delay in diagnosing cancer. Attention should therefore be given to the patient's medical history, especially of those with a previous history of cancer, and all dental practitioners should be aware of the possibility of metastases that may be confused with periapical disease. Finally, endodontists are well placed to recognize malignant and metastatic oral lesions during the initial clinical stages, given that their treatments are usually based on frequent dental appointments and long-term follow-ups.
Resumo:
From November 1982 to May 1999, 28 children with Rett syndrome were followed-up for a medium period of 6 years and 2 months. Regression of developmental milestones started at the age between 5 and 20 months. Nineteen cases of typical Rett syndrome had uneventful pre and perinatal periods, loss of previously acquired purposeful hand skills, mental and motor regression and developed hand stereotypies; sixteen had head growth deceleration and 12 gait apraxia. Nine patients were atypical cases, 2 formes frustres, 2 congenital, 3 with early seizure onset, 1 preserved speech and 1 male. Epilepsy was present in 21 patients, predominantly partial seizures and the drug of choise was carbamazepine (15 patients). In the initial evaluation most patients were distributed on Stages II and III and on follow-up on Stages III and IV. Three children died.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.
Resumo:
The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.
Resumo:
134
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física