18 resultados para FRUIT NUTRITIONAL LEVEL
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
The purpose of this study was to assess whether the adhesive permits the collateral repair of axons originating from a vagus nerve to the interior of a sural nerve graft, and whether low-level laser therapy (LLLT) assists in the regeneration process. Study sample consisted of 32 rats randomly separated into three groups: Control Group (CG; n=8), from which the intact sural nerve was collected; Experimental Group (EG; n=12), in which one of the ends of the sural nerve graft was coapted to the vagus nerve using the fibrin glue; and Experimental Group Laser (EGL; n=12), in which the animals underwent the same procedures as those in EG with the addition of LLLT. Ten weeks after surgery, the animals were euthanized. Morphological analysis by means of optical and electron microscopy, and morphometry of the regenerated fibers were employed to evaluate the results. Collateral regeneration of axons was observed from the vagus nerve to the interior of the autologous graft in EG and EGL, and in CG all dimensions measured were greater and presented a significant difference in relation to EG and EGL, except for the area and thickness of the myelin sheath, that showed significant difference only in relation to the EG. The present study demonstrated that the fibrin glue makes axonal regeneration feasible and is an efficient method to recover injured peripheral nerves, and the use of low-level laser therapy enhances nerve regeneration.
Resumo:
Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.
Resumo:
The aim of this study was to evaluate by clinical and laboratory parameters how cystic fibrosis (CF) affects growth and nutritional status of children who were undergoing CF treatment but did not receive newborn screening. A historical cohort study of 52 CF patients younger than 10 years of age were followed in a reference center in Campinas, Southeast Brazil. Anthropometric measurements were abstracted from medical records until March/2010, when neonatal screening program was implemented. Between September/2009 and March/2010, parental height of the 52 CF patients were also measured. Regarding nutritional status, four patients had Z-scores ≤ -2 for height/age (H/A) and body mass index/age (BMI/A). The following variables were associated with improved H/A ratio: fewer hospitalizations, longer time from first appointment to diagnosis, longer time from birth to diagnosis and later onset of respiratory disease. Forced vital capacity [FVC(%)], forced expiratory flow between 25-75% of FVC [FEF25-75(%)], forced expiratory volume in the first second [FEV1(%)], gestational age, birth weight and early respiratory symptoms were associated with IMC/A. Greater number of hospitalizations, diagnosis delay and early onset of respiratory disease had a negative impact on growth. Lower spirometric values, lower gestational age, lower birth weight, and early onset of respiratory symptoms had negative impact on nutritional status. Malnutrition was observed in 7.7% of cases, but 23% of children had nutritional risk.
Resumo:
To analyze the relationship between parity, pre-pregnancy body mass index (BMI), and gestational weight gain (GWG). This observational controlled study was conducted from November 2013 to April 2014, with postpartum women who started antenatal care up to 14 weeks and had full-term births. Data were collected from medical records and antenatal cards. Descriptive and bivariate analyses were performed. The significance level was 5%. Data were collected from 130 primiparous and 160 multiparous women. At the beginning of prenatal care, 54.62% of the primiparous were eutrophic, while the majority of multiparous were overweight or obese (62.51%). Multiparas are two times more likely to be obese at the beginning of their pregnancies, when compared to primiparas. The average pre-pregnancy weight and final pregnancy weight was significantly higher in multiparous, however, the mean GWG was higher among primiparous. We found an inverse correlation between parity and the total GWG, but initial BMI was significantly higher in multiparas. Nevertheless, monitoring of the GWG through actions that promote a healthier lifestyle is needed, regardless of parity and nutritional status, in order to prevent excessive GWG and postpartum weight retention and consequently inadequate pre-pregnancy nutritional status in future pregnancies.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.
Resumo:
Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física