51 resultados para Occurs
Resumo:
A revision of the Brazilian species of Lonchocarpus s. str. is presented. This study is based on field observation and an analysis of approximately 1,200 herbarium collections. Nine species are recognized, L. cultratus, L. hedyosmus, L. latifolius, L. macrocarpus, L. nitidus, L. pluvialis, L. sericeus, L. spiciflorus, and L. violaceus, which grow in forests and are usually associated with river banks. Lonchocarpus sericeus and L. cultratus have a wide distribution throughout Brazil, whereas L. hedyosmus, L. macrocarpus, L. spiciflorus, and L. latifolius are restricted to the Amazonian domain. Lonchocarpus pluvialis occurs in the Central-West (Mato Grosso do Sul and Goiás) and Southeast (São Paulo) regions. Lonchocarpus violaceus is found in the states of Bahia and Espírito Santo, and is reported for the first time for Brazil. Identification keys, descriptions, and illustrations, in addition to information about habitat, geographic distribution and taxonomic and nomenclatural comments, are provided for the species. Four new synonyms and five lectotypifications are proposed.
Resumo:
The work aims to present an overview of social movements in actuality, in the Latin America, and presents a mapping of their main forms in Brazil. The search ponders the educational character of their actions, both for its participants, as for society in general and public agencies. The basic premise of assertion that social movements are sources of innovation and knowledge-generating arrays. However, because it is not an isolated process but social-political character, the paper search joints in the network of relationships that establish movements in political, economic and socio-cultural country, to understand the factors that generate learning built and values of political culture that are being built. . The text highlights movements that occurs in the areas of education - formal and non-formal education.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.
Resumo:
The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física