Metamorfose planar via métodos Level Set e Particle Level Set para a reconstrução de superfícies tridimensionais

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Metamorfose planar via métodos Level Set e Particle Level Set para a reconstrução de superfícies tridimensionais

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Percepção dos usuários, profissionais de saúde e gestores sobre o modelo de atendimento oftalmológico no Hospital Regional de Divinolândia - São Paulo

Purpose: This study aimed to evaluate the assistance quality through the perception of the users and municipal health managers (mayors, health secretaries and screening team). Methods: A transversal and descriptive study was carried out. Results: The sample was comprised by 359 users and 48 managers. Medical assistance was considered excellent by 79.6% of the users, 93.7% of the managers, 87.5% of the health secretaries and 100% of the screening team. Reception received a great evaluation by 73.8% of the users and 93.8% of the selectors. Conclusion: The assistance model used at the Ophthalmologic Clinic of Divinolândia obtained a high level of satisfaction pleasing both users and managers.

Análise cinemática tridimensional do salto em distância de atletas de alto nível em competição

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Determinação da velolcidade critica como referencia do limiar anaerobio para o nado costas

Universidade Estadual de Campinas . Faculdade de Educação Física

Indicadores dermatoglificos de aptidão fisica e efeito dos treinamentos intervalado versus continuo na pratica da corrida em piscina funda : intervenção com mulheres obesas

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos de diferentes frequencias semanais de treinamento com pesos sobre a composição corporal e capacidades motoras em homens idosos

Universidade Estadual de Campinas . Faculdade de Educação Física

O papel da propriocepção no desenvolvimento da força muscular e da flexibilidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida e composição corporal : características do envelhecimento bem sucedido = Quality of life and body composition : characteristics of successful aging

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação entre métodos para mensuração da potência aeróbia em atletas tetraplégicos= : Comparison of methods for aerobic power assessment in athletes with tetraplegia

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação da associação de diferentes programas de atividade física aplicados no local de trabalho sobre o nível de atividade física e qualidade de vida de trabalhadores do setor administrativo de comunidade universitária

Universidade Estadual de Campinas . Faculdade de Educação Física