28 resultados para scale development
Resumo:
The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.
Resumo:
There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.
Resumo:
• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.
Resumo:
Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.
Resumo:
To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas, Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física