37 resultados para Shipping process without debit
Resumo:
Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.
Resumo:
This article aims at discussing the contributions of the Bakhtinian Circle theories to foreign language teaching and learning (HALL et al., 2005), as far as the first years of formal education in Brazil are concerned. Up to the present moment, foreign languages, including English, are not officially part of the National Curriculum of the first five schooling years. Due to the importance of English in a globalized world and despite all the controversial socio-educational impacts of such an influence, there has been an increase in the interest in this discipline at the beginning years of Brazilian public education (ROCHA, 2006), which has been happening at an irregular pace and without official parameters. Therefore, the relevance of this work lies on the possible guidelines it may offer to support a more effective, situated and meaningful teaching-learning process in that context. Standing for a pluralistic approach to language education, we take the bakhtinian speech genres as organizers of the educational process. We strongly believe that through a dialogic, pluralistic and trans/intercultural teaching (MAHER, 2007), whose main objective is the development of multi (COPE e KALANTZIS, 2000) and critical (COMBER, 2006) literacies, the hybridization of genres and cultures, as well as the creation of third spaces (KOSTOGRIZ, 2005; KUMARAVADIVELU, 2008) can happen. From this perspective, foreign language teaching and learning play a transformative role in society and English is seen as a boundary object (STAR e GRIESEMER, 1989), in and by which diversity, pluralism and polyphony can naturally find their way.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.
Resumo:
A case of neuronal ceroid-lipofuscinosis (NCL) is reported in a 11-year-old girl, whose main symptoms were progressive dementia since the age of 4 years and choreic movements since age 10. Seizures, myoclonus and visual deterioration were absent and optic fundi were normal. A cerebral biopsy disclosed two basic types of stored substance in the cytoplasm of neurons: a) severely balloned nerve cells in cortical layers HI and V contained a non-autofluorescent material, which stained with PAS and Sudan Black B in frozen, but not in paraffin sections; ultrastructurally, these neurons showed abundant corpuscles similar to the membranous cytoplasmic bodies of Tay-Sachs disease and, in smaller amounts, also zebra bodies; b) slightly distended or non-distended neurons in all layers contained lipopigment granules, which were autofluorescent, PAS-positive and sudanophil in both frozen and paraffin sections; their ultrastructure was closely comparable to that of lipofuscin. Similar bodies were found in the swollen segments of axons and in a few astrocytes and endothelial cells. The histochemical and ultrastructural demonstration of large amounts of lipopigments allows a presumptive classification of the case as NCL. However, the presence of involuntary movements, the absence of visual disturbances and the unusual ultrastructural features place the patient into a small heterogeneous group within the NCL. A better classification of such unique instances of the disease must await elucidation of the basic enzymatic defects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
A dimensão prática na preparação profissional em educação física : concepção e organização acadêmica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física