32 resultados para Lpfö 98
Resumo:
The taxonomic position of a bacterium isolated from water samples from the Rio Negro, in Amazon, Brazil, was determined by using a polyphasic approach. The organism formed a distinct phyletic line in the Chromobacterium 16S rRNA gene tree and had chemotaxonomic and morphological properties consistent with its classification in this genus. It was found to be closely related to Chromobacterium vaccinii DSM 25150(T) (98.6 % 16S rRNA gene similarity) and shared 98.5 % 16S rRNA gene similarity with Chromobacterium piscinae LGM 3947(T). DNA-DNA relatedness studies showed that isolate CBMAI 310(T) belongs to distinct genomic species. The isolate was readily distinguished from the type strain of these species using a combination of phenotypic and chemotaxonomic properties. Thus, based on genotypic and phenotypic data, it is proposed that isolate CBMAI 310(T) (=DSM 26508(T)) be classified in the genus Chromobacterium as the type strain of a novel species, namely, Chromobacterium amazonense sp. nov.
Polymorphism In Lep And Lepr May Modify Leptin Levels And Represent Risk Factors For Thyroid Cancer.
Resumo:
Purpose. To understand the role of polymorphisms in the LEP (rs7799039 and rs2167270) and LEPR (rs1137101 and rs1137100) genes in DTC susceptibility and their effect on leptin levels. Methods. We studied 153 patients with DTC and 234 controls through TaqMan SNP Genotyping and ELISA, comparing these data to the clinicopathological data of patients with DTC. Results. Patients with AA genotype of rs7799039 had higher levels of serum leptin (9.22 ± 0.98 ng/mL) than those with AG genotype (10.07 ± 0.60 ng/mL; P = 0.005). Individuals with AG genotype of rs2167270 also produced higher serum leptin levels (10.05 ± 0.59 ng/mL) than the subjects with GG genotype (9.52 ± 0.79 ng/mL; P < 0.05). A multivariate logistic regression adjusted for gender, age, and BMI showed that the AG genotype of rs7799039 was an independent risk for DTC (OR, 11.689; P = 0.0183; 95% CI, 1.516-90.119). Similarly, AG and GG genotypes of rs1137101 increased the susceptibility to DTC (OR, 3.747; P = 0.027; 95% CI, 1.161-12.092 and OR, 5.437; P = 0.013; 95% CI, 1.426-20.729). Conclusions. We demonstrated that rs7799039 and rs2167270 polymorphisms modify the serum leptin concentrations in patients with DTC. Furthermore, polymorphisms rs7799039 and rs1137101 increase the risk of DTC development, although they do not correlate with tumor aggressiveness.
Resumo:
BACKGROUND: The model for end-stage liver disease (MELD) was developed to predict short-term mortality in patients with cirrhosis. There are few reports studying the correlation between MELD and long-term posttransplantation survival. AIM: To assess the value of pretransplant MELD in the prediction of posttransplant survival. METHODS: The adult patients (age >18 years) who underwent liver transplantation were examined in a retrospective longitudinal cohort of patients, through the prospective data base. We excluded acute liver failure, retransplantation and reduced or split-livers. The liver donors were evaluated according to: age, sex, weight, creatinine, bilirubin, sodium, aspartate aminotransferase, personal antecedents, brain death cause, steatosis, expanded criteria donor number and index donor risk. The recipients' data were: sex, age, weight, chronic hepatic disease, Child-Turcotte-Pugh points, pretransplant and initial MELD score, pretransplant creatinine clearance, sodium, cold and warm ischemia times, hospital length of stay, blood requirements, and alanine aminotransferase (ALT >1,000 UI/L = liver dysfunction). The Kaplan-Meier method with the log-rank test was used for the univariable analyses of posttransplant patient survival. For the multivariable analyses the Cox proportional hazard regression method with the stepwise procedure was used with stratifying sodium and MELD as variables. ROC curve was used to define area under the curve for MELD and Child-Turcotte-Pugh. RESULTS: A total of 232 patients with 10 years follow up were available. The MELD cutoff was 20 and Child-Turcotte-Pugh cutoff was 11.5. For MELD score > 20, the risk factors for death were: red cell requirements, liver dysfunction and donor's sodium. For the patients with hyponatremia the risk factors were: negative delta-MELD score, red cell requirements, liver dysfunction and donor's sodium. The regression univariated analyses came up with the following risk factors for death: score MELD > 25, blood requirements, recipient creatinine clearance pretransplant and age donor >50. After stepwise analyses, only red cell requirement was predictive. Patients with MELD score < 25 had a 68.86%, 50,44% and 41,50% chance for 1, 5 and 10-year survival and > 25 were 39.13%, 29.81% and 22.36% respectively. Patients without hyponatremia were 65.16%, 50.28% and 41,98% and with hyponatremia 44.44%, 34.28% and 28.57% respectively. Patients with IDR > 1.7 showed 53.7%, 27.71% and 13.85% and index donor risk <1.7 was 63.62%, 51.4% and 44.08%, respectively. Age donor > 50 years showed 38.4%, 26.21% and 13.1% and age donor <50 years showed 65.58%, 26.21% and 13.1%. Association with delta-MELD score did not show any significant difference. Expanded criteria donors were associated with primary non-function and severe liver dysfunction. Predictive factors for death were blood requirements, hyponatremia, liver dysfunction and donor's sodium. CONCLUSION: In conclusion MELD over 25, recipient's hyponatremia, blood requirements, donor's sodium were associated with poor survival.
Resumo:
This text offers some contributions to the debate on the changes proposed to the National Curricular Directives to reform secondary education in Brazil. In the first part, the political and economic scene is evaluated as the context which generated the last stage of reforms in the educational field in the 90s. It questions the option for a model of structural reform (in the Brazilian case more restricted to the Program for Reform of Professional Education - PROEP) and of the curriculum, whose themes find their justification in the contemporary economic, social cultural and political context. It discusses the use of a model that bases itself on experiences developed in other countries and takes the international orientation of the multilateral organizations as its theoretical methodological reference, leaving out the peculiarities and injunctions of the Brazilian political administrative system. Such a policy measure can increase the tension and distance normally existing between government programs and the possibility of their real implementation in the school network. In the second part, it discusses the Resolution of the National Education Council, the Congress on Basic Education, no.3, of 16.698 that instituted the National Curricular Directives for secondary education, as well as the Legal Bases - Part I - of the National Curricular Parameters for secondary education. The analysis of official discourse takes Bardin's (1977, p. 209) proposals as its methodological reference for the models of structural analysis, seeking to make the implicit values and the connotations of the legal texts explicit
Resumo:
The aim of this work was to develop and to validate a methodology using HPLC for the simultaneous determination of folates and folic acid in foods. The limits of detection and the recovery rates for the vitamins in the certified reference materials were respectively 5 pg/mL and 94-108% for 5-MTHF, 7 pg/mL and 97-102% for THF, 30 pg/mL and 97.9-104% for 5-FTHF, 30 pg/mL and 95-107 for 10-FFA, 5 ng/mL and 97-102% for FA and 5 ng/mL and 98-103% for 10-MFA. Repeatability showed a coefficient of variation below 3.9% for all the vitamins. The proposed methodology was shown to be efficient when applied to different certified reference materials, namely pig's liver (BCR487), powdered milk (BCR421) and a vegetable mixture (BCR485).
Resumo:
A full factorial design 2³ was used to evaluate the effect of process variables in chemical peeling of yacon roots, cultivated in Curitiba, State of Paraná. Eleven treatments, with three central points, were done in which they had been evaluated at three different levels of sodium hydroxide solution, % (g/100 mL) [6, 10, 14], temperature of the same solution, °C [70, 80, 90], and residence time in the sodium hydroxide solution, minutes [2, 4, 6]. All the studied variables had affected significantly (p<0.05) the yield of yacon roots subjected to chemical peeling. The variable that most affected the yield was the time of permanence in the sodium hydroxide solution. The mathematical model obtained for the yield (%) was good with R² aj = 0.8497, and non significant lack of fit (p=0.9312).Therefore, the model can be used for predictive purposes. In the central point a satisfactory yield (84% to 87%) with a high percentage of removed peel was obtained (96% to 98%) indicating that the treatment with 10% of sodium hydroxide solution, temperature of 80º C per 4 minutes can be used in the chemical peeling of yacon roots.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To evaluate the learning effect, short-term fluctuation and long-term fluctuation in healthy subjects undergoing frequency doubling perimetry (FDP). METHODS: Twenty healthy young subjects underwent FDT (program N30, full threshold) in one eye (right). Each subject was tested once in the first three sessions and three times in the fourth session. Both short- and long-term fluctuations were studied as the average fluctuation of all the tested points or as a point-to-point fluctuation. To study the learning effect, the MDs values of the first session were compared to the second, third and fourth sessions. RESULTS: In the short-term analysis (3 examination done in the last session), the total mean sensitivity was 31.91 ± 1.20 dB and the mean MD and PSD were 0.84 ± 1.85 and 3.73 ± 1.55 dB, respectively. The average short-term fluctuation was 1.72 ± 0.38 dB. When the four examination, performed at different visits, were compared, the average mean sensitivity of all sessions and the average long-term fluctuation were 31.75 ± 1.11 and 2.16 ± 0.26 dB, respectively. The MD averages of the first, second, third and fourth tests were 0.11 ± 2.14 dB, 0.47 ± 1.64 dB, 1.16 ± 1.62 dB and 0.98 ± 1.92 dB respectively. The MD difference between the first and the third and between the first and the fourth examinations were statistically significant (p<0.05). CONCLUSION: The threshold sensitivity detected by FDP is influenced by both short- and long-term fluctuations. We observed a mild learning effect that shoud be taken into account whenever a patient undergoes this test for the first time.
Resumo:
PURPOSE: To determine the association between language and number of citations of ophthalmology articles published in Brazilian journals. METHODS: This study was a systematic review. Original articles were identified by review of documents published at the two Brazilian ophthalmology journals indexed at Science Citation Index Expanded - SCIE [Arquivos Brasileiros de Oftalmologia (ABO) and Revista Brasileira de Oftalmologia (RBO)]. All document types (articles and reviews) listed at SCIE in English (English Group) or in Portuguese (Portuguese Group) from January 1, 2008 to December 31, 2009 were included, except: editorial materials; corrections; letters; and biographical items. The primary outcome was the number of citations through the end of second year after publication date. Subgroup analysis included likelihood of citation (cited at least once versus no citation), journal, and year of publication. RESULTS: The search at the web of science revealed 382 articles [107 (28%) in the English Group and 275 (72%) in the Portuguese Group]. Of those, 297 (77.7%) were published at the ABO and 85 (23.3%) at the RBO. The citation counts were statistically significantly higher (P<0.001) in the English Group (1.51 - SD 1.98 - range 0 to 11) compared with the Portuguese Group (0.57 - SD 1.06 - range 0 to 7). The likelihood citation was statistically significant higher (P<0.001) in the English Group (70/107 - 65.4%) compared with the Portuguese Group (89/275 - 32.7%). There were more articles published in English at the ABO (98/297 - 32.9%) than at the RBO (9/85 - 10.6%) [P<0.001]. There were no significant difference (P=0.967) at the proportion of articles published in English at the years 2008 (48/172 - 27.9%) and 2009 (59/210 - 28.1%). CONCLUSION: The number of citations of articles published in Portuguese at Brazilian ophthalmology journals is lower than the published in English. The results of this study suggest that the editorial boards should strongly encourage the authors to adopt English as the main language in their future articles.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas, Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física