[factors Impacting The Growth And Nutritional Status Of Cystic Fibrosis Patients Younger Than 10 Years Of Age Who Did Not Undergo Neonatal Screening.]

The aim of this study was to evaluate by clinical and laboratory parameters how cystic fibrosis (CF) affects growth and nutritional status of children who were undergoing CF treatment but did not receive newborn screening. A historical cohort study of 52 CF patients younger than 10 years of age were followed in a reference center in Campinas, Southeast Brazil. Anthropometric measurements were abstracted from medical records until March/2010, when neonatal screening program was implemented. Between September/2009 and March/2010, parental height of the 52 CF patients were also measured. Regarding nutritional status, four patients had Z-scores ≤ -2 for height/age (H/A) and body mass index/age (BMI/A). The following variables were associated with improved H/A ratio: fewer hospitalizations, longer time from first appointment to diagnosis, longer time from birth to diagnosis and later onset of respiratory disease. Forced vital capacity [FVC(%)], forced expiratory flow between 25-75% of FVC [FEF25-75(%)], forced expiratory volume in the first second [FEV1(%)], gestational age, birth weight and early respiratory symptoms were associated with IMC/A. Greater number of hospitalizations, diagnosis delay and early onset of respiratory disease had a negative impact on growth. Lower spirometric values, lower gestational age, lower birth weight, and early onset of respiratory symptoms had negative impact on nutritional status. Malnutrition was observed in 7.7% of cases, but 23% of children had nutritional risk.

Artificial Gait In Complete Spinal Cord Injured Subjects: How To Assess Clinical Performance.

Objective Adapt the 6 minutes walking test (6MWT) to artificial gait in complete spinal cord injured (SCI) patients aided by neuromuscular electrical stimulation. Method Nine male individuals with paraplegia (AIS A) participated in this study. Lesion levels varied between T4 and T12 and time post injured from 4 to 13 years. Patients performed 6MWT 1 and 6MWT 2. They used neuromuscular electrical stimulation, and were aided by a walker. The differences between two 6MWT were assessed by using a paired t test. Multiple r-squared was also calculated. Results The 6MWT 1 and 6MWT 2 were not statistically different for heart rate, distance, mean speed and blood pressure. Multiple r-squared (r2 = 0.96) explained 96% of the variation in the distance walked. Conclusion The use of 6MWT in artificial gait towards assessing exercise walking capacity is reproducible and easy to apply. It can be used to assess SCI artificial gait clinical performance.

Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.99580%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

Breaking Oil-in-water Emulsions Stabilized By Yeast.

Several biotechnological processes can show an undesirable formation of emulsions making difficult phase separation and product recovery. The breakup of oil-in-water emulsions stabilized by yeast was studied using different physical and chemical methods. These emulsions were composed by deionized water, hexadecane and commercial yeast (Saccharomyces cerevisiae). The stability of the emulsions was evaluated varying the yeast concentration from 7.47 to 22.11% (w/w) and the phases obtained after gravity separation were evaluated on chemical composition, droplet size distribution, rheological behavior and optical microscopy. The cream phase showed kinetic stability attributed to mechanisms as electrostatic repulsion between the droplets, a possible Pickering-type stabilization and the viscoelastic properties of the concentrated emulsion. Oil recovery from cream phase was performed using gravity separation, centrifugation, heating and addition of demulsifier agents (alcohols and magnetic nanoparticles). Long centrifugation time and high centrifugal forces (2h/150,000×g) were necessary to obtain a complete oil recovery. The heat treatment (60°C) was not enough to promote a satisfactory oil separation. Addition of alcohols followed by centrifugation enhanced oil recovery: butanol addition allowed almost complete phase separation of the emulsion while ethanol addition resulted in 84% of oil recovery. Implementation of this method, however, would require additional steps for solvent separation. Addition of charged magnetic nanoparticles was effective by interacting electrostatically with the interface, resulting in emulsion destabilization under a magnetic field. This method reached almost 96% of oil recovery and it was potentially advantageous since no additional steps might be necessary for further purifying the recovered oil.

Investigation Of Genetic Factors Underlying Typical Orofacial Clefts: Mutational Screening And Copy Number Variation.

Typical orofacial clefts (OFCs) comprise cleft lip, cleft palate and cleft lip and palate. The complex etiology has been postulated to involve chromosome rearrangements, gene mutations and environmental factors. A group of genes including IRF6, FOXE1, GLI2, MSX2, SKI, SATB2, MSX1 and FGF has been implicated in the etiology of OFCs. Recently, the role of the copy number variations (CNVs) has been studied in genetic defects and diseases. CNVs act by modifying gene expression, disrupting gene sequence or altering gene dosage. The aims of this study were to screen the above-mentioned genes and to investigate CNVs in patients with OFCs. The sample was composed of 23 unrelated individuals who were grouped according to phenotype (associated with other anomalies or isolated) and familial recurrence. New sequence variants in GLI2, MSX1 and FGF8 were detected in patients, but not in their parents, as well as in 200 control chromosomes, indicating that these were rare variants. CNV screening identified new genes that can influence OFC pathogenesis, particularly highlighting TCEB3 and KIF7, that could be further analyzed. The findings of the present study suggest that the mechanism underlying CNV associated with sequence variants may play a role in the etiology of OFC.

Ecotoxicological Effects Of Carbofuran And Oxidised Multiwalled Carbon Nanotubes On The Freshwater Fish Nile Tilapia: Nanotubes Enhance Pesticide Ecotoxicity.

The interactions of carbon nanotubes with pesticides, such as carbofuran, classical contaminants (e.g., pesticides, polyaromatic hydrocarbons, heavy metals, and dyes) and emerging contaminants, including endocrine disruptors, are critical components of the environmental risks of this important class of carbon-based nanomaterials. In this work, we studied the modulation of acute carbofuran toxicity to the freshwater fish Nile tilapia (Oreochromis niloticus) by nitric acid treated multiwalled carbon nanotubes, termed HNO3-MWCNT. Nitric acid oxidation is a common chemical method employed for the purification, functionalisation and aqueous dispersion of carbon nanotubes. HNO3-MWCNT were not toxic to Nile tilapia at concentrations ranging from 0.1 to 3.0 mg/L for exposure times of up to 96 h. After 24, 48, 72 and 96 h, the LC50 values of carbofuran were 4.0, 3.2, 3.0 and 2.4 mg/mL, respectively. To evaluate the influence of carbofuran-nanotube interactions on ecotoxicity, we exposed the Nile tilapia to different concentrations of carbofuran mixed together with a non-toxic concentration of HNO3-MWCNT (1.0 mg/L). After 24, 48, 72, and 96 h of exposure, the LC50 values of carbofuran plus nanotubes were 3.7, 1.6, 0.7 and 0.5 mg/L, respectively. These results demonstrate that HNO3-MWCNT potentiate the acute toxicity of carbofuran, leading to a more than five-fold increase in the LC50 values. Furthermore, the exposure of Nile tilapia to carbofuran plus nanotubes led to decreases in both oxygen consumption and swimming capacity compared to the control. These findings indicate that carbon nanotubes could act as pesticide carriers affecting fish survival, metabolism and behaviour.

Saúde dos adolescentes: um estudo de base populacional em Campinas, São Paulo, Brasil

We estimated the prevalence of chronic diseases and other health problems reported by adolescents in relation to social and demographic variables and nutritional status. This cross-sectional population-based survey analyzed data from the Health Survey in Campinas, São Paulo State, Brazil, 2008. We used descriptive statistics and associations between variables with the chisquare test. Prevalence of chronic diseases among adolescents was 19.17%, with asthma showing the highest prevalence (7.59%), followed by heart disease (1.96%), hypertension (1.07%), and diabetes 0.21%. Prevalence rates were 61.53% for health problems, 40.39% for allergy, and 24.83% for frequent headache or migraine. After multivariate analysis using Poisson regression, the factors associated with chronic disease were age 15 to 19 years (PR = 1.38), not attending school (PR = 1.46), having children (PR = 1.84), and obesity (PR = 1.54). Female gender (PR = 1.12) was statistically associated with health problems. The study illustrates that adolescence is a life stage in which chronic disease and health problems can occur.

Dispersão de sementes de Vismia cayennensis (Jacq.) Pers. (Guttiferae) por morcegos na região de Manaus, Amazonas

We studied the feeding behavior of bats and their role in the seed dispersal of Vismia cayennensis in Manaus region, Amazonas State, northern Brazil. The characteristics of the plant and its fruits fit the chiropterocory syndrome. Five species of phyllostomid bats fed on Vismia fruits: Sturnira lilium, Sturnira tildae, Artibeus concolor, Carollia perspicillata and Rhinophylla pumilio. Apparently there is a relationship between flock foraging behavior and fruit availability in early night. The feeding behavior was similar for all bat species, varying with the presentation mode of the fruits. Seed germination tests and the distributional patterns of the plants indicate that bats are the dispersers of V. cayennensis.

O Complexo Vegetacional da Zona Litorânea no Ceará: Pecém, São Gonçalo do Amarante

Due to its geographical location, the northeastern Coast of Brazil (Litoral Setentrional do Nordeste - LSN) is a hotter and drier climate than the eastern coast. In addition, because of its proximity to caatinga and cerrado, the LSN contains species from these vegetation biomes and from the restinga on the coast, which comprise different plant formations and creates a vegetation complex. Despite the great importance of this ecotone, there are few studies about its flora. The objective of this work was to contribute to what is known about the floristic and phytosociological composition of this region. We made a floristic survey in the area (between 2007 and 2011), consulted herbaria data from the region and made a phytosociological study in a stretch of coastal semideciduous forest (mata de tabuleiro). The study recorded 382 plant species from 96 families. In the phytosociological survey (0.32 ha) we recorded 2,970 individuals and 52 species. The most abundant plants surveyed were the trees Manilkara triflora, Chamaecrista ensiformis and Guapira nitida and the shrubs Cordiera sessilis and Maytenus erythroxyla (average height 3.8 m, average diameter 6.2 cm, basal area 39.28 m²/ha). The local flora includes floristic elements of caatinga, cerrado and restinga, corroborating the idea that the plant community of the coastal region of Ceará has an ecotonal nature.

Otimização do descascamento químico de raízes do yacon (Polymnia sonchifolia Poepp.)

A full factorial design 2³ was used to evaluate the effect of process variables in chemical peeling of yacon roots, cultivated in Curitiba, State of Paraná. Eleven treatments, with three central points, were done in which they had been evaluated at three different levels of sodium hydroxide solution, % (g/100 mL) [6, 10, 14], temperature of the same solution, °C [70, 80, 90], and residence time in the sodium hydroxide solution, minutes [2, 4, 6]. All the studied variables had affected significantly (p<0.05) the yield of yacon roots subjected to chemical peeling. The variable that most affected the yield was the time of permanence in the sodium hydroxide solution. The mathematical model obtained for the yield (%) was good with R² aj = 0.8497, and non significant lack of fit (p=0.9312).Therefore, the model can be used for predictive purposes. In the central point a satisfactory yield (84% to 87%) with a high percentage of removed peel was obtained (96% to 98%) indicating that the treatment with 10% of sodium hydroxide solution, temperature of 80º C per 4 minutes can be used in the chemical peeling of yacon roots.

Estudo comparativo dos métodos de estimativa da idade óssea de Greulich & Pyle e Tanner & Whitehouse

The purpose of this study was to verify whether the Greulich & Pyle (GP), Greulich & Pyle Visual (GPV) and Tanner & Whitehouse (TW) methods for estimating skeletal age could be applied in the Brazilian population, and which of these three methods could be considered more reliable when compared with the chronological age of the individuals. This study was based on one hundred and sixty volunteers (80 females and 80 males) with ages between 6 years and 10 months and 14 years and 9 months. The results showed that for the GP method, the correlations with chronological age were 0.95 for males and 0.97 for females. For the GPV method, the correlations were 0.96 and 0.97, respectively and for TW, 0.96 and 0.97. The results showed that the Greulich & Pyle, Greulich & Pyle Visual and Tanner & Whitehouse methods presented high correlation values when compared with the chronological age of the individuals. Corrective factors were established to make these methods applicable to the Brazilian population.

PREDIÇÃO DA ATIVIDADE DE ÁGUA E RELAÇÃO ENTRE A ATIVIDADE DE ÁGUA E A DEPRESSÃO DO PONTO DE CONGELAMENTO DE SUCOS DE FRUTAS

This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.