Algorithmic computation of knot polynomials of secondary structure elements of proteins

The classification of protein structures is an important and still outstanding problem. The purpose of this paper is threefold. First, we utilize a relation between the Tutte and homfly polynomial to show that the Alexander-Conway polynomial can be algorithmically computed for a given planar graph. Second, as special cases of planar graphs, we use polymer graphs of protein structures. More precisely, we use three building blocks of the three-dimensional protein structure-alpha-helix, antiparallel beta-sheet, and parallel beta-sheet-and calculate, for their corresponding polymer graphs, the Tutte polynomials analytically by providing recurrence equations for all three secondary structure elements. Third, we present numerical results comparing the results from our analytical calculations with the numerical results of our algorithm-not only to test consistency, but also to demonstrate that all assigned polynomials are unique labels of the secondary structure elements. This paves the way for an automatic classification of protein structures.

Functional analysis of the C-terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in Salmonella enterica

WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.

Structure-activity studies on position 14 of human alpha-calcitonin gene-related peptide

A structure-activity study was performed to examine the role of position 14 of human alpha-calcitonin gene-related peptide (h-alpha-CGRP) in activating the CGRP receptor. Interestingly, position 14 of h-alpha-CGRP contains a glycyl residue and is part of an alpha-helix spanning residues 8-18. Analogues [Ala(14)]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, [Asn(14)]-h-alpha-CGRP, and [Pro(14)]-h-alpha-CGRP were synthesized by solid phase peptide methodology and purified by RP-HPLC. Secondary structure was measured by circular dichroism spectroscopy. Agonist activities were determined as the analogues' ability to stimulate amylase secretion from guinea pig pancreatic acini and to relax precontracted porcine coronary arteries. Analogues [Ala(1)4]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, and [Asn(14)]-h-alpha-CGRP, all containing residues with a high helical propensity in position 14, were potent full agonists compared to h-alpha-CGRP in both tissues. Interestingly, replacement of Gly(14) of h-alpha-CGRP with these residues did not substantially increase the helical content of these analogues. [Pro(14)]-h-alpha-CGRP, predictably, has significantly lower helical content and is a 20-fold less potent agonist on coronary artery, known to contain CGRP-1 receptor subtypes, and an antagonist on pancreatic acini, known to contain CGRP-2 receptor subtypes. In conclusion, the residue in position 14 plays a structural role in stabilizing the alpha-helix spanning residues 8-18. The alpha-helix is crucial for maintaining highly potent agonist effects of h-alpha-CGRP at CGRP receptors. The wide variety of functional groups that can be tolerated in position 14 with no substantial modification of agonist effects suggests the residue in this position is not in contact with the CGRP receptor. [Pro(14)]-h-alpha-CGRP may be a useful pharmacological tool to distinguish between CGRP-1 and CGRP-2 receptor subtypes.

Influence of alpha-helicity, amphipathicity and D-amino acid incorporation on the peptide-induced mast cell activation

Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.

Probing the Unfolded Configurations of a β-Hairpin Using Sketch-Map

This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.

Hybrid Diphenylalkyne-Dipeptide Oligomers Induce Multistrand β-Sheet Formation

Functionalized diphenylalkynes provide a template for the presentation of protein-like surfaces composed of multistrand β-sheets. The conformational properties of three-, four-, and seven-stranded systems have been investigated in the solid- and solution-state. This class of molecule may be suitable for the mediation of therapeutically relevant protein-protein interactions.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.