Dasybasis (Agelanius) cortesi, a new species of horse fly from Chile (Diptera: Tabanidae: Diachlorini)

The female and male of Dasybasis (Agelanius) cortesi, new species, is described and illustrated from specimens collected in the National Reserve of Río Clarillo, Cordillera Province, Central Chile. Its relationships to other Dasybasis species are discussed.

Dasybasis elquiensis, a new species of horse fly from Northern Chile (Diptera: Tabanidae: Diachlorini)

The female of Dasybasis elquiensis, new species, is described and illustrated from specimens collected in Paso La Ternera, Elqui Province, north Chile. Its relationships to other Dasybasis species are discussed.

The Immature Stages of Protodasyapha (Protodasyapha) hirtuosa (Philippi) and their Comparison with the Immature Stages of other Pangoniini (Diptera: Tabanidae: Pangoniinae)

The terrestrial immature stages of the Chilean horse fly, Protodasyapha (Protodasyapha) hirtuosa (Philippi), are described. P.(P.) hirtuosa resembles Ectenopsis vulpecula Macquart and Caenoprosopon trichocera (Bigot) from Australia, and Esenbeckia delta Hine from North America, in both the larval and pupal stages. Some characters that are shared between these species are unique and provide evidence of their monophyletic origin. Larvae of P. hirtuosa were found 3-5 below of the soil surface and associated with larvae of Coleoptera, Lepidoptera and Diptera.

Seasonality and relative abundance of Tabanidae (Diptera) captured on horses in the Pantanal, Brazil

Once a month, from June 1992 to May 1993, collections of tabanids on horse were conducted in the Nhecolândia, Pantanal State of Mato Grosso do Sul, Brazil. Tabanid catches using hand nets were conducted from sunrise to sunset at grassland and cerradão (dense savanna) habitats. A total of 3,442 tabanids from 21 species,12 genera, and 3 subfamilies were collected. Although species abundance varied seasonally depending on habitat, no habitat specificity was observed for the most abundant species. In the grassland, 1,625 (47.2%) tabanids belonging to 19 species were collected, while 1,817 (52.8%) tabanids from 17 species were caught in the cerradão. The number of tabanid species varied from 7 during winter (July/August) to 15 in the spring (October). Tabanus importunus (56%) was the most abundant species, followed by T. occidentalis (8.2%), and T. claripennis (8.1%). The tabanid peak, in October, coincided with the beginning of the rainy season. The population peak of most species, including those with higher vector potential, suggests that the rainy season can be considered as the period of potentially higher risk of mechanical transmission of pathogens by tabanids to horses in the region.

Activity of Tabanids (Insecta: Diptera: Tabanidae) Attacking the Reptiles Caiman crocodilus (Linn.) (Alligatoridae) and Eunectes murinus (Linn.) (Boidae), in the Central Amazon, Brazil

Tabanid females are better known as hematophagous on man and other mammals, and linked to mechanical transmission of parasites. The association between tabanids and reptiles is poorly known, but has been gaining more corroboration through experiments and occasional observation in the tropics. The present study was conducted at a military base (CIGS/BI-2), situated 54 km from Manaus, Amazonas, in a small stream in a clearing (02°45'33"S; 59°51'03"W). Observations were made monthly, from April 1997 to March 1998, during two consecutive days. At the same time, other vertebrate animals were offered, including humans. However in this paper only data obtained on a common caiman, Caiman crocodilus (Linn.), and an anaconda, Eunectes murinus (Linn.), in diurnal observations from 05:30 a.m. to 18:30 p.m., will be discussed. A total of 254 tabanid specimens were collected, 40 from the anaconda and 214 from the caiman. Four tabanid species were recorded on these two reptiles: Stenotabanus cretatus Fairchild, S. bequaerti Rafael et al., Phaeotabanus nigriflavus (Kröber) and Tabanus occidentalis Linn. Diurnal activities showed species-specific patterns. The first three species occurred only in the dry season. T. occidentalis occurred during the whole observation period, and with increased frequency at the end of the dry season. We observed preferences for body area and related behavior of the host. Observations on the attack of tabanids on one dead caiman are also presented.

Molecular and parasitological detection of Leishmania spp. in a dipteran of the species Tabanus importunus

A leishmaniose é uma importante zoonose, de caráter crônico, causada por protozoários do gênero Leishmania spp. Esta protozoose tem como principal vetor os flebotomíneos, sendo que, no Brasil, o Lutzomyia longipalpis é a principal espécie incriminada na transmissão da leishmaniose Visceral Americana. A presença do ácido desoxirribonucleico (DNA) do parasito em ectoparasitos, como carrapatos e pulgas, tem gerado especulações quanto a existência de novos vetores no ciclo da leishmaniose. Foi objetivo deste estudo relatar a detecção molecular de Leishmania spp. em uma mutuca da espécie Tabanus importunus que parasitava um cão oligossintomático infectado por Leishmania spp. A análise molecular amplificou o DNA do protozoário na cabeça, na região torácica e no abdomen do tabanídeo, resultando como positivo para complexo Leishmania. Este é o primeiro relato da presença de DNA de Leishmania spp. em insetos dipteros da espécie T. importunus.

An investigation into the effects of homopteran honeydew sugars versus floral nectar sugars on black fly longevity, flight performance and digestion /

Floral nectar is thought to be the primary carbohydrate source for most dipteran species. However, it has been shown that black flies (Burgin & Hunter 1997 a,b,c), mosquitoes (Foster 1995; Burkett et al. 1999; Russell & Hunter 2002), deer flies (Magnarelli & Burger 1984; Janzen & Hunter 1998; Ossowski & Hunter 2000), horse flies (Schutz & Gaugler 1989; Hunter & Ossowski 1999) and sand flies (MacVicker et al. 1990; Wallbanks et al. 1990; Cameron et al. 1992, 1995; Schlein & Jacobson 1994, 1999; Hamilton & EI Naiem 2000) feed on homopteran honeydew as well as floral nectar. Prior to 1997 floral nectar was thought to be the main source of carbohydrates for black flies. However, Burgin & Hunter (1 997a) demonstrated that up to 35% of black flies had recently consumed meals of homo pte ran honeydew. This information has necessitated a re-assessment of many life history aspects of black flies. Attempts are being made to examine the effects of nectar versus honeydew on black fly fecundity and parasite transmission (Hazzard 2003). Recently, Stanfield and Hunter (unpublished data) have shown that in female black flies, honeydew sugars produce flights of longer distance and duration than do nectar sugars. This thesis examines two aspects of black fly biology as it relates to sugar meal consumption. First, the effects of honeydew and nectar on black fly longevity are examined. Second, the proximate causation behind longer flight performances in honeydew-fed flies will be examined. The comparison between these two sources is important because nectar is composed of mainly simple sugars (monosaccharides and disaccharides) whereas honeydew is composed of both simple and complex sugars (including trisaccharides and tetrasaccharides ).

Prevalence of gastric lesions (ulcers and/or erosions) and their relationship to possible stressfull factors in asymptomatic Quarter Horse foals: endoscopic survey

A úlcera gástrica constitui-se numa das mais importantes causas de desconforto abdominal em eqüinos jovens. Com o objetivo de se verificar a prevalência de lesões gástricas (úlceras e/ou erosões) e sua relação com fatores como estresse, idade, e sexo, sessenta potros da raça Quarto de Milha não portadores de sinais clínicos compatíveis com lesões gástricas foram submetidos à gastroscopia. Os potros foram divididos em quatro faixas etárias de 15 animais cada uma, sendo: 1 a 30 dias, 31 a 60 dias, 61 a 90 dias e 91 a 120 dias de idade. A prevalência de lesões gástricas foi de 43,3%. Animais com idade entre 61 a noventa dias foram os mais acometidos. Não houve diferença significativa entre as faixas etárias. Descamações do epitélio aglandular ocorreram em nove potros (60%) entre um e trinta dias, em seis (40%) entre 31 e sessenta dias e em apenas dois (6,6%) com idade superior a sessenta dias. Fatores considerados estressantes, como infestação intensa por carrapatos (29), problemas respiratórios (3), dermatopatias (3), babesiose (2), onfaloflebite (1), diarréia (1), problemas ortopédicos (1) e ferida lacerante com presença de miíase (1) não influenciaram a ocorrência das lesões. Machos e fêmeas foram igualmente acometidos.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Management Of Severe Thoracic Impalement Trauma Against Two-wheeled Horse Carriage: A Case Report And Literature Review.

Thoracic injuries in general are of great importance due to their high incidence and high mortality. Thoracic impalement injuries are rare but severe due to the combination of cause, effect and result. This study's primary objective is to report the case of a young man who was impaled by a two-wheeled horse carriage shaft while crashing his motorcycle in a rural zone. An EMT-B ferry was called at the crash scene and a conscious patient was found, sustaining a severe impalement injury to the left hemithorax, suspended over the floor by the axial skeleton with the carriage shaft coming across his left chest. As a secondary objective, a literature review of thoracic impalement injuries is performed. Cases of thoracic impalement injury require unique and individualized care based on injury severity and affected organs. Reported protocols for managing impalement injuries are entirely anecdotal, with no uniformity on impaled patient's approach and management. In penetrating trauma, it is essential not to remove the impaled object, so that possible vascular lesions remain buffered by the object, avoiding major bleeding and exsanguination haemorrhage. Severed impaled thoracic patients should be transferred to a specialist centre for trauma care, as these lesions typically require complex multidisciplinary treatment. High-energy thoracic impalement injuries are rare and hold a high mortality rate, due to the complexity of trauma and associated injuries such as thoracic wall and lung lesions. Modern medicine still seems limited in cases of such seriousness, not always with satisfactory results.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Serosurvey of antibodies against spotted fever group Rickettsia spp. in horse farms in Northern Paraná, Brazil

Brazilian spotted fever (BSF) is an emerging disease most likely caused by Rickettsia rickettsii. The objective of the present study was to estimate the seroprevalence of BSF rickettsia infections in equines from six horse farms located in Londrina County, Paraná, Southern Brazil. Six owners of horse farms situated in Cambé, Santa Fé, Guaraci and Londrina municipalities participated in the study. All farms were located in areas where BSF has not been reported. A total of 273 horses were sampled and their sera were tested by indirect Immunofluorescence assay (IFA) using R. rickettsii and R. parkeri antigens. Titers equal to and greater than 64 were considered positive. Of 273 sera tested, 15 (5.5%) reacted to R. rickettsii and 5 (1.8%) to R. parkeri. Five out of the six farms studied revealed seropositive animals and seropositivity rate ranged from 0 to 13%. The titers ranged from 64 to 512, and four samples had a titer of 512. Nine animals reacted to R. rickettsii with titers four-fold higher than those for R. parkeri. These results suggest that horses in Northern Paraná may have been exposed to rickettsiae identical or closely related to R. rickettsii.