Diversity of functional traits of fleshy fruits in a species-rich Atlantic rain forest

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Syndromes cliniquement isolés dans l'accident vasculaire cérébral

Chaque année, près de 14000 personnes sont victimes d'un accident vasculaire cérébral (AVC) en Suisse (1). Parmi elles, 3000-4000 individus décèdent des suites de leur attaque et environ 2000 personnes survivent avec des séquelles qui peuvent être relativement importantes. Cette affection a donc un poids non négligeable en terme de morbidité et de mortalité ; dans les pays indistrualisés, elle représente la première cause de handicap, la deuxième cause de démence ainsi que la troisième cause de mortalité. Il existe deux types d'AVC : les accidents ischémiques et les accidents hémorragiques (2,3). Dans environ 80% des cas, les AVC sont des accidents ischémiques, résultant d'une occlusion artérielle ou veineuse - les ischémies sur occlusion veineuse étant rares en comparaison de celles sur occulsion artérielle. En outre, on parle d'accident ischémiques transitoires (AIT) lorsque les symptomes sont spontanément résolutifs en moins de 24 heures. Les accidents hémorragiques, quant à eux, ne constituent qu'une minorité des AVC (20%) et sont secondaires à une rupture de vaisseau. La physiopathologie des différents types d'AVC a été particulièrement bien étudiée, ce qui a permis de mettre en évidence un certain nombre de causes. Un AVC peut donc être d'origine cardiaque (embole à point de départ cardiaque, fibrillation auriculaire), d'origine athéromateuse (embole sur plaque d'athéromatose des vaisseaux pré-cérébraux) ou encore, la conséquence directe d'une hypertension artérielle (maladie des petits vaisseaux, hémorragies intracérébrales) (3). Il existe également des causes un peu moins fréquentes, telles que les dissections aortiques, les ruptures d'anévrisme, les malformations artério-veineuses, les états pro-coagulants, les vasculites, la prise de toxiques. De nombreux facteurs de risque ont été mis en évidence (3). Certains d'entre eux, tels que l'âge, le sexe ou l'éthnie, ne sont pas modifiables. Mais il en est d'autres sur lesquels il est possible d'avoir un impact positif et leur identification fait donc partie intégrante du bilan de base chez les patients victimes d'AVC. Il s'agit de l'hypertension artérielle, du diabète, du tabagisme actif et de l'hypercholestérolémie. La présentation clinique de l'AVC est fonction du territoire vasculaire touché (3). Historiquement, la localisation et la compréhension des fonctions cérébrales ont été le fruit de corrélations anatomo-clinique puis radiologico-clinique (2). Dans la majorité des cas, on étudiait la partie commune à toutes les lésions de différents patients présentant un symptôme, et cette partie était présumée responsable de cette fonction. Néanmoins, le patient pouvait présenter d'autres symptômes associés, ce qui peut représenter un certain biais. A l'heure actuelle, l'imagerie fonctionnelle remplace progressivement ces corrélations radiologico- cliniques (2). Finalement, des études de cas isolés, avec lésions relativement circonscrites, ont également contribués à la compréhension des fonctions cérébrales (4-12). Le but principal de cette étude est d'analyser les syndromes cliniquement isolées (CIS, atteinte d'une fonction cérébrale, d'un segment corporel) dans le registre lausannois des accidents vasculaires cérébraux en terme de facteurs de risques, et de caractéristiques de l'AVC (origine, localisation) afin de déterminer des facteurs indépendants de survenue de telles atteintes, d'un point de vue général et pour chacune d'entre elles.

Vertebrate dispersal syndromes along the Atlantic forest: broad-scale patterns and macroecological correlates

Aim To assess the geographical variation in the relative importance of vertebrates, and more specifically of birds and mammals, as seed dispersal agents in forest communities, and to evaluate the influence of geographical and climatic factors on the observed trends.Location One hundred and thirty-five forest communities in the Brazilian Atlantic forest.Methods We collected data on dispersal modes for 2292 woody species. By combining species x site with species x trait matrices, we obtained the percentages of endozoochory, ornithochory, mastozoochory and the mean fruit diameter for the local forest communities. We used Spearman's correlation to assess bivariate relationships between variables. Subsequently, we performed paired t-tests to verify if variations in frequency of dispersal modes and mean fruit diameter were influenced by altitude or temperature. Then, we applied multiple linear regressions to evaluate the effect of geographical and climatic variables on variation in the relative frequency of dispersal modes and mean fruit diameter across communities.Results We found no consistent latitudinal or longitudinal trend in the percentage of vertebrate-dispersed species, neither bird- nor mammal-dispersed species along the Atlantic forest. Endozoochory was affected chiefly by annual mean rainfall, increasing towards moister sites. Forest communities located at higher altitudes had a higher percentage of bird-dispersed species. Even when sites with identical values of annual mean temperature were compared, altitude had a positive effect on ornithochory. Conversely, we found a higher percentage of mammal-dispersed species in warmer forests, even when locations at the same altitudinal belts were contrasted. Fruit diameter was clearly related to altitude, decreasing towards higher elevations.Main conclusions This is the first analysis of a large data set on dispersal syndromes in tropical forest communities. Our findings support the hypotheses that: (1) geographical variation in the relative number of fleshy fruit species is mainly driven by moisture conditions and is relatively independent of geographical location, and (2) broad-scale trends in fruit size correspond to geographical variation in the relative importance of mammals and birds as seed dispersal agents at the community level.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Cognitive And Behavioral Heterogeneity In Genetic Syndromes.

this study aimed to investigate the cognitive and behavioral profiles, as well as the psychiatric symptoms and disorders in children with three different genetic syndromes with similar sociocultural and socioeconomic backgrounds. thirty-four children aged 6 to 16 years, with Williams-Beuren syndrome (n=10), Prader-Willi syndrome (n=11), and Fragile X syndrome (n=13) from the outpatient clinics of Child Psychiatry and Medical Genetics Department were cognitively assessed through the Wechsler Intelligence Scale for Children (WISC-III). Afterwards, a full-scale intelligence quotient (IQ), verbal IQ, performance IQ, standard subtest scores, as well as frequency of psychiatric symptoms and disorders were compared among the three syndromes. significant differences were found among the syndromes concerning verbal IQ and verbal and performance subtests. Post-hoc analysis demonstrated that vocabulary and comprehension subtest scores were significantly higher in Williams-Beuren syndrome in comparison with Prader-Willi and Fragile X syndromes, and block design and object assembly scores were significantly higher in Prader-Willi syndrome compared with Williams-Beuren and Fragile X syndromes. Additionally, there were significant differences between the syndromes concerning behavioral features and psychiatric symptoms. The Prader-Willi syndrome group presented a higher frequency of hyperphagia and self-injurious behaviors. The Fragile X syndrome group showed a higher frequency of social interaction deficits; such difference nearly reached statistical significance. the three genetic syndromes exhibited distinctive cognitive, behavioral, and psychiatric patterns.

Ten-eleven-translocation 2 (tet2) Is Downregulated In Myelodysplastic Syndromes.

TET2, a member of the ten-eleven-translocation (TET) family genes that modify DNA by converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), is located in chromosome 4q24 and is frequently mutated in myeloid malignancies. The impact of TET2 mutation on survival outcomes is still controversial; however, functional studies have proved that it is a loss-of-function mutation that impairs myeloid cell differentiation and contributes to the phenotype of myeloid neoplasia. We, herein, aimed to investigate TET2 expression in patients with myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML). A significantly decreased TET2 expression was observed in bone marrow cells from AML (n = 53) and patients with MDS (n = 64), compared to normal donors (n = 22). In MDS, TET2 expression was significantly reduced in RAEB-1/RAEB-2 compared to other WHO 2008 classifications, and a lower TET2 expression was observed at the time of MDS disease progression in four of five patients. In multivariate analysis, low TET2 expression (P = 0.03), male gender (P = 0.02), and WHO 2008 classification (P < 0.0001) were independent predictors of poorer overall survival. These results suggest that defective TET2 expression plays a role in the MDS pathophysiology and predicts survival outcomes in this disease.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.