microRNA156-targeted SPL/ SBP box transcription factors regulate tomato ovary and fruit development

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Shaping the Dicot Fruit: Molecular and Genomic Approaches to Fruit Development

The fruit is one of the most complex and important structures produced by flowering plants, and understanding the development and maturation process of fruits in different angiosperm species with diverse fruit structures is of immense interest. In the work presented here, molecular genetics and genomic analysis are used to explore the processes that form the fruit in two species: The model organism Arabidopsis and the diploid strawberry Fragaria vesca. One important basic question concerns the molecular genetic basis of fruit patterning. A long-standing model of Arabidopsis fruit (the gynoecium) patterning holds that auxin produced at the apex diffuses downward, forming a gradient that provides apical-basal positional information to specify different tissue types along the gynoecium’s length. The proposed gradient, however, has never been observed and the model appears inconsistent with a number of observations. I present a new, alternative model, wherein auxin acts to establish the adaxial-abaxial domains of the carpel primordia, which then ensures proper development of the final gynoecium. A second project utilizes genomics to identify genes that regulate fruit color by analyzing the genome sequences of Fragaria vesca, a species of wild strawberry. Shared and distinct SNPs among three F. vesca accessions were identified, providing a foundation for locating candidate mutations underlying phenotypic variations among different F. vesca accessions. Through systematic analysis of relevant SNP variants, a candidate SNP in FveMYB10 was identified that may underlie the fruit color in the yellow-fruited accessions, which was subsequently confirmed by functional assays. Our lab has previously generated extensive RNA-sequencing data that depict genome-scale gene expression profiles in F. vesca fruit and flower tissues at different developmental stages. To enhance the accessibility of this dataset, the web-based eFP software was adapted for this dataset, allowing visualization of gene expression in any tissues by user-initiated queries. Together, this thesis work proposes a well-supported new model of fruit patterning in Arabidopsis and provides further resources for F. vesca, including genome-wide variant lists and the ability to visualize gene expression. This work will facilitate future work linking traits of economic importance to specific genes and gaining novel insights into fruit patterning and development.

Gene Expression Noise in Spatial Patterning: hunchback Promoter Structure Affects Noise Amplitude and Distribution in Drosophila Segmentation

Positional information in developing embryos is specified by spatial gradients of transcriptional regulators. One of the classic systems for studying this is the activation of the hunchback (hb) gene in early fruit fly (Drosophila) segmentation by the maternally-derived gradient of the Bicoid (Bcd) protein. Gene regulation is subject to intrinsic noise which can produce variable expression. This variability must be constrained in the highly reproducible and coordinated events of development. We identify means by which noise is controlled during gene expression by characterizing the dependence of hb mRNA and protein output noise on hb promoter structure and transcriptional dynamics. We use a stochastic model of the hb promoter in which the number and strength of Bcd and Hb (self-regulatory) binding sites can be varied. Model parameters are fit to data from WT embryos, the self-regulation mutant hb(14F), and lacZ reporter constructs using different portions of the hb promoter. We have corroborated model noise predictions experimentally. The results indicate that WT (self-regulatory) Hb output noise is predominantly dependent on the transcription and translation dynamics of its own expression, rather than on Bcd fluctuations. The constructs and mutant, which lack self-regulation, indicate that the multiple Bcd binding sites in the hb promoter (and their strengths) also play a role in buffering noise. The model is robust to the variation in Bcd binding site number across a number of fly species. This study identifies particular ways in which promoter structure and regulatory dynamics reduce hb output noise. Insofar as many of these are common features of genes (e. g. multiple regulatory sites, cooperativity, self-feedback), the current results contribute to the general understanding of the reproducibility and determinacy of spatial patterning in early development.

"Anteroposterior Patterning: How the Hox Genes Help Us Tell Our Heads from Our ***es"

The fundamental problem of developmental biology is how a single cell- a fertilized egg- is able to produce an entire organism in all its complexity. One essential aspect of this process is spatial patterning-in essence, instructing cells as to their location in developing body so that they can exhibit characteristics appropriate to their functions. he Hox genes, first discovered in mutant fruit fly "hopeful monsters" with extra pairs of wings or legs growing out of their heads, confer spatial information along the anteroposterior axis in animals from worms to humans. Prof Marin's research focuses on the roles of specific Hox genes in sculpting the developing entral nervous system of the fruit fly and how the same gene can direct a neuron to die, survive, or send its axon in search of different connections, depending on cellular context.

Hox genes and regional patterning of the vertebrate body plan

Several decades have passed since the discovery of Hox genes in the fruit fly Drosophila melanogaster. Their unique ability to regulate morphologies along the anteroposterior (AP) axis (Lewis, 1978) earned them well-deserved attention as important regulators of embryonic development. Phenotypes due to loss- and gain-of-function mutations in mouse Hox genes have revealed that the spatio-temporally controlled expression of these genes is critical for the correct morphogenesis of embryonic axial structures. Here, we review recent novel insight into the modalities of Hox protein function in imparting specific identity to anatomical regions of the vertebral column, and in controlling the emergence of these tissues concomitantly with providing them with axial identity. The control of these functions must have been intimately linked to the shaping of the body plan during evolution.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.