897 resultados para fruit fly
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.
Resumo:
A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.
Resumo:
The demonstration that both oxygen atoms of 1,7-dioxaspiro[5.5] undecane (1), the sex-pheromone of the female olive fly, originate from dioxygen, strongly implicates monooxygenase mediated processes in assembly of (1), and reveals unexpected complexity in the formation of its nine-carbon precursor.
Resumo:
The relative oviposition rate of the parasitoid Fopius arisanus (Sonan) was investigated across three frugivorous tephritid species, Bactrocera tryoni Froggart, Bactrocera jarvisi (Tryon) and Bactrocera cucumis French. Choice and no-choice tests were both used. The suitability of these three species for sustaining larval development and survival to the adult stage was also assessed. Fopius arisanus parasitized all three tephritid species. regardless of the method of exposure, but showed stronger preference for B. tryoni and B. jarvisi over B. cucumis. Superparasitism was extremely rare. Successful development of F. arisanus varied across host species. Bactrocera tryoni yielded significantly more parasitoids than B. jarvisi, but no wasps emerged from B. cucumis puparia. Tests were set up in replicated trials. but results were not homogeneous across trials. We discuss the host relationships of F. arisanus with reference to this variation and in relation to host suitability for larval development.
Resumo:
The electroantennogram method was used to investigate the number of distinct olfactory receptor neuron types responding to a range of behaviorally active volatile chemicals in gravid Queensland fruit flies, Bactrocera tryoni. Three receptor neuron types were identified. One type responds to methyl butyrate, 2-butanone, farnesene, and carbon dioxide; a second to ethanol; and a third to n-butyric acid and ammonia. The receptor neuron type responding to methyl butyrate, 2-butanone, farnesene, and carbon dioxide consists of three subtypes. The presence of a limited number of receptor neuron types responding to a diverse set of chemicals and the reception of carbon dioxide by a receptor neuron type that responds to other odorants are novel aspects of the peripheral olfactory discrimination process.
Resumo:
Single-unit electrophysiology was used to record the nerve impulses from the carbon dioxide receptors of female Queensland fruit flies, Bactrocera tryoni. The receptors responded to stimulation in a phasic-tonic manner and also had a period of inhibition of the nerve impulses after the end of stimulation, at high stimulus intensities. The cell responding to carbon dioxide was presented with a range of environmental odorants and found to respond to methyl butyrate and 2-butanone. The coding characteristics of the carbon dioxide cell and the ability to detect other odorants are discussed, with particular reference to the known behavior of the fly.
Resumo:
A circulated heated-air treatment at 92% RH to achieve and maintain a minimum fruit core temperature of 44°C for 2 h is shown to disinfest tomatoes against Queensland fruit fly, Bactrocera tryoni (Froggatt) for market access quarantine purposes. The efficacy of the treatment exceeded 99.99%, tested at the 95% confidence level. An estimated 78 439 eggs were used for large-scale trials, as the stage of the pest most tolerant of heat at the treatment temperature.
Resumo:
Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera, Tephritidae). Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L.), cashew (Anacardium occidentale L.), star fruit (Averrhoa carambola L.), guava (Psidium guajava L.), soursop (Annona muricata L.), yellow mombin (Spondias mombin L.), Malay apple (Syzygium malaccense L.), and umbu (Spondias tuberosa L.). The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.
Resumo:
The objective of this work was to develop suitable and economic diets for mass rearing Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae). Diets containing sugar beet bagase, wheat bran, brewer yeast, and others with wheat bran and palletized soybean protein from Brazil were tested. Diets based on soybean protein have shown promising results regarding pupal recovery, pupal weight and adult emergence. Soybean bagase in the form of pellets with 60% of protein can be a very important substitute for other expensive sources of protein.
Resumo:
The objective of this study was to evaluate the diversity of fruit fly (Diptera: Tephritidae) species that use myrtaceous fruit, particularly guava, as hosts in several localities in the state of Bahia and to determine the infestation rates, pupal viability rates, and fruit fly-parasitoid associations. Sampling of myrtaceous fruit was carried out in 24 municipalities in different regions in the state of Bahia. Four fruit fly species, Anastrepha fraterculus, Anastrepha zenildae, Anastrepha sororcula, and Ceratitis capitata were obtained from the collected fruit. Three parasitoid species (Hymenoptera: Braconidae) emerged from Anastrepha larvae/pupae, Doryctobracon areolatus, Utetes anastrephae, and Asobara anastrephae. Doryctobracon areolatus emerged from A. fraterculus, A. sororcula and A. zenildae; Utetes anastrephae emerged from A. fraterculus and A. zenildae; and Asobara anastrephae emerged from A. fraterculus. Fruit fly and myrtaceous fruit associations are reported for the first time in several municipalities in the state of Bahia. A. zenildae was found infesting Syzygium malaccense for the first time in Brazil.
Resumo:
The sublethal effect of extracts of Azadirachta indica on Ceratitis capitata was evaluated. Two pairs of flies were treated in plastic tubes with cotton placed in plastic cages. An artificial diet (hydrolyzed protein + sugar) was provided ad libitum. The extracts affected significantly the longevity of C. capitata. The pre-oviposition period were not significantly affected by the extracts. The A. indica branches extracted with dichloromethane (888 ppm) affected significantly the fecundity and fertility, reducing the number of eggs laid to approximately 80 % and the egg hatching by 30 % at the 8th day. Therefore, the neem branches extracted with dichloromethane affected the reproduction of C. capitata.
Resumo:
Climate change affects the rate of insect invasions as well as the abundance, distribution and impacts of such invasions on a global scale. Among the principal analytical approaches to predicting and understanding future impacts of biological invasions are Species Distribution Models (SDMs), typically in the form of correlative Ecological Niche Models (ENMs). An underlying assumption of ENMs is that species-environment relationships remain preserved during extrapolations in space and time, although this is widely criticised. The semi-mechanistic modelling platform, CLIMEX, employs a top-down approach using species ecophysiological traits and is able to avoid some of the issues of extrapolation, making it highly applicable to investigating biological invasions in the context of climate change. The tephritid fruit flies (Diptera: Tephritidae) comprise some of the most successful invasive species and serious economic pests around the world. Here we project 12 tephritid species CLIMEX models into future climate scenarios to examine overall patterns of climate suitability and forecast potential distributional changes for this group. We further compare the aggregate response of the group against species-specific responses. We then consider additional drivers of biological invasions to examine how invasion potential is influenced by climate, fruit production and trade indices. Considering the group of tephritid species examined here, climate change is predicted to decrease global climate suitability and to shift the cumulative distribution poleward. However, when examining species-level patterns, the predominant directionality of range shifts for 11 of the 12 species is eastward. Most notably, management will need to consider regional changes in fruit fly species invasion potential where high fruit production, trade indices and predicted distributions of these flies overlap.