958 resultados para fly colonization


Relevância:

60.00% 60.00%

Publicador:

Resumo:

The occurrence of 27 second-instar larvae of the flesh fly Microcerella halli (Engel, 1931) (Diptera, Sarcophagidae) in a carcass of a snake usually called as Urutu, Bothrops alternatus (Duméril, Bibron & Duméril, 1854) (Serpentes, Viperidae, Crotalinae) is reported. The snake was kept in captivity in a snake farm in Morungaba, São Paulo state, Brazil. Descriptions of reptile carcass colonization by insects and general biological data of this flesh fly are scarce and this necrophagic behavior is described for the first time in literature.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Sarcophagidae and Calliphoridae related to Rhinella schneideri (Anura, Bufonidae), Bothrops moojeni (Reptilia, Serpentes) and Mabuya frenata (Reptilia, Lacertilia) carcasses in Brasília, Brazil. This paper presents a list of necrophagous insects associated with small size carrions of two reptiles and one amphibian, found in areas of riparian forests and Cerrado sensu stricto physiognomies in a Conservation Unit located in Brasilia, Distrito Federal. We found seven species of insects related to these carcasses, being five Sarcophagidae, one Calliphoridae and one Braconidae parasitoid wasp. Lucilia eximia and Peckia (Pattonella) intermutans were the most abundant species in the study, corroborating with other studies that suggests that these species have specializations for colonization of small size animal carcasses.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Occurrence of Microcerella halli (Engel) (Diptera, Sarcophagidae) in snake carrion in southeastern Brazil. The occurrence of 27 second-instar larvae of the flesh fly Microcerella halli (Engel, 1931) (Diptera, Sarcophagidae) in a carcass of a snake usually called as Urutu, Bothrops alternatus (Dumeril, Bibron & Dumeril, 1854) (Serpentes, Viperidae, Crotalinae) is reported. The snake was kept in captivity in a snake farm in Morungaba, São Paulo state, Brazil. Descriptions of reptile carcass colonization by insects and general biological data of this flesh fly are scarce and this necrophagic behavior is described for the first time in literature.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Differences in the phoresy of the mites Macrocheles muscaedomesticae (Scopoli, 1972) (Macrochelidae) and Uroseius sp. (Polyaspidae) on the house fly, Musca domestica (Linnaeus, 1758) and the similarities in their phoretic dispersal and parasitism are discussed, altogether with the effects on predator-prey interactions. The prevalence and intensity of phoresy in the mite species were significantly related to the attachment site on the hosts. The phoresy of Uroseius sp. was correlated with temperature but not with rainfall and relative humidity. Selective pressure in the environment resulted in displacement and the emergence of local and regional populations. These results suggest that in each habitat the populations will use different resources and will show several relationships with other species, as well as a selection for morphological and behavioral types.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Migration and colonization of the oesophagus by Leishmania mexicana parasites were enhanced after digestion of a second bloodmeal intake in Lutzomyia evansi. This event has epidemiological significance since it affects the infection susceptibility of this sand fly species, which is a proven vector of L. chagasi in Colombian and Venezuelan visceral leishmaniasis foci. Also, it may explain the host seeking behaviour displayed by some partially bloodfed flies found inside houses.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Lutzomyia longipalpis females received single and mixed infections with Endotrypanum and Leishmania. Two biological parameters were analyzed: the percentage of infected females and the distribution of flagellates in the gut of the females. The principal comparisons were performed between (1) two strains of Endotrypanum, (2) cloned versus primary sample of one strain of Endotrypanum, (3) Endotrypanum versus Leishmania guyanensis, and (4) the pattern of flagellates behaviour by optical microscopy in females with single or mixed infection versus the identification of parasites isolated from digestive tracts by isoenzyme electrophoresis. Flagellates of Endotrypanum showed distinct patterns of infection suggesting that there is variation between and within strains. The distribution of Endotrypanum and L. guyanensis differed significantly in relation to the colonization of the stomodeal valve. In co-infection with L. guyanensis, a large number of flagellates were seen to be plentifully infecting the stomodeal valve in significantly more specimens than in females infected by Endotrypanum only. However, the electrophoretic profiles of isoenzymes of parasites recovered from all co-infected specimens corresponded to Endotrypanum. This suggests that the mere correlation sand fly infection-biochemical analysis of isolates may induce parasitological incorrect consideration.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study represents the first detailed multi-proxy palaeoenvironmental investigation associated with a Late Iron Age lake-dwelling site in the eastern Baltic. The main objective was to reconstruct the environmental and vegetation dynamics associated with the establishment of the lake-dwelling and land-use during the last 2,000 years. A lacustrine sediment core located adjacent to a Late Iron Age lake-dwelling, medieval castle and Post-medieval manor was sampled in Lake Āraiši. The core was dated using spheroidal fly-ash particles and radiocarbon dating, and analysed in terms of pollen, non-pollen palynomorphs, diatoms, loss-on-ignition, magnetic susceptibility and element geochemistry. Associations between pollen and other proxies were statistically tested. During ad 1–700, the vicinity of Lake Āraiši was covered by forests and human activities were only small-scale with the first appearance of cereal pollen (Triticum and Secale cereale) after ad 400. The most significant changes in vegetation and environment occurred with the establishment of the lake-dwelling around ad 780 when the immediate surroundings of the lake were cleared for agriculture, and within the lake there were increased nutrient levels. The highest accumulation rates of coprophilous fungi coincide with the occupation of the lake-dwelling from ad 780–1050, indicating that parts of the dwelling functioned as byres for livestock. The conquest of tribal lands during the crusades resulted in changes to the ownership, administration and organisation of the land, but our results indicate that the form and type of agriculture and land-use continued much as it had during the preceding Late Iron Age.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Insect pest phylogeography might be shaped both by biogeographic events and by human influence. Here, we conducted an approximate Bayesian computation (ABC) analysis to investigate the phylogeography of the New World screwworm fly, Cochliomyia hominivorax, with the aim of understanding its population history and its order and time of divergence. Our ABC analysis supports that populations spread from North to South in the Americas, in at least two different moments. The first split occurred between the North/Central American and South American populations in the end of the Last Glacial Maximum (15,300-19,000 YBP). The second split occurred between the North and South Amazonian populations in the transition between the Pleistocene and the Holocene eras (9,100-11,000 YBP). The species also experienced population expansion. Phylogenetic analysis likewise suggests this north to south colonization and Maxent models suggest an increase in the number of suitable areas in South America from the past to present. We found that the phylogeographic patterns observed in C. hominivorax cannot be explained only by climatic oscillations and can be connected to host population histories. Interestingly we found these patterns are very coincident with general patterns of ancient human movements in the Americas, suggesting that humans might have played a crucial role in shaping the distribution and population structure of this insect pest. This work presents the first hypothesis test regarding the processes that shaped the current phylogeographic structure of C. hominivorax and represents an alternate perspective on investigating the problem of insect pests. © 2013 Fresia et al.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.