972 resultados para fig fly


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this work was to select semivariogram models to estimate the population density of fig fly (Zaprionus indianus; Diptera: Drosophilidae) throughout the year, using ordinary kriging. Nineteen monitoring sites were demarcated in an area of 8,200 m2, cropped with six fruit tree species: persimmon, citrus, fig, guava, apple, and peach. During a 24 month period, 106 weekly evaluations were done in these sites. The average number of adult fig flies captured weekly per trap, during each month, was subjected to the circular, spherical, pentaspherical, exponential, Gaussian, rational quadratic, hole effect, K-Bessel, J-Bessel, and stable semivariogram models, using ordinary kriging interpolation. The models with the best fit were selected by cross-validation. Each data set (months) has a particular spatial dependence structure, which makes it necessary to define specific models of semivariograms in order to enhance the adjustment to the experimental semivariogram. Therefore, it was not possible to determine a standard semivariogram model; instead, six theoretical models were selected: circular, Gaussian, hole effect, K-Bessel, J-Bessel, and stable.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The objective of this study was to evaluate the occurrence of Drosophilidae and their parasitoids in coffee fruits in Cravinhos, SP, Brazil. The fruits were collected directly from the tree, and a portion was exposed under the canopy. Fifty-nine drosophilid pupae were collected in all, of which 31 adults (including two Ganaspis exemplars) emerged. The survival rate of all pupae was 49.2%. Thirty-five drosopholid pupae were obtained from the fruit trees, 24 of which later emerged, three different species: Zaprionus indianus Gupta, Drosophila nebulosa Sturtevant and D. simulans Sturtevant. From the fruits under the canopy of plants were obtained 24 pupae of four different species: Z. indianus, D. cardini Sturtevant, D. immigrans Sturtevant and D. willistoni Sturtevant. The emergence of two Ganaspis sp. (Hymenoptera: Figitidae) examples, with a parasitism rate of 8.3%, was also observed. Half of the drosophilids collected are introduced species and represented 79% of the adults emerged. Associations between Z. indianus, D. cardini, D. immigrans, D. nebulosa, D. simulans and D. willistoni and the coffee crop are reported herein.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Resumo: Drosophila suzukii (Matsumura) foi recentemente detectado causando danos idade para morangos no Brasil. Infestação na cultura de morango tem frequentemente foi observado conjuntamente com a presença de Zaprionus indianus Gupta. este estudo investigou a suscetibilidade de morangos em três amadurecimento estágios para infestação de D. suzukii e Z. indianus e sua interação. Abstracts: Drosophila suzukii (Matsumura) has been recently detected causing damage to strawberries in Brazil. Infestation in strawberry culture has often been observed jointly with the presence of Zaprionus indianus Gupta. This study investigated the susceptibility of strawberries at three ripening stages to infestation of D. suzukii and Z. indianus and their interaction. In the laboratory, strawberries cv. Albion at different ripening stages (green, semi-ripe and ripe) were exposed to D. suzukii and Z. indianus for 24 h in choice and no-choice bioassays. Additionally, we evaluated the effects of mechanical damage incurred artificially or by D. suzukii ovi-position on Z. indianus infestation. In no-choice bioassay, there were no significant differences in fruit susceptibility to D. suzukii infestation at different ripening stages. However, in choice bioassay, D. suzukii adults preferred to oviposit on R fruit. The presence of mechanical damage did not increase susceptibility of fruit to D. suzukii oviposition. For Z. indianus , there was greater susceptibility of R fruit in relation to SR and G fruit in both the choice and no-choice bioassays. There was a significant and positive interaction of mechanical damage and damage caused by D. suzukii to R fruit and infestation by Z. indianus , which was not observed in SR and G fruit. Although infestation of Z. indianus is related to attack damaged or decaying fruit, this work shows that this species has the ability to oviposit and develop in healthy strawberry fruit with and increased infestation level when the fruit has damage to its epidermis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND: Drosophila suzukii is a primary insect pest that causes direct damage to fruits with a thin epidermis such as strawberries, cherries and blueberries. In strawberry fields, the co-occurrence of D. suzukii and Zaprionus indianus has increased production losses. This study evaluated the toxicities and effects of insecticidal baits to control adults and larvae of both D. suzukii and Z. indianus . RESULTS: Organophosphate (dimethoate and malathion), spinosyn (spinosad and spinetoram), pyrethroid (lambda-cyhalothrin) and diamide (cyantraniliprole) insecticides exhibited high toxicity to both adults and larvae of D. suzukii and Z. indianus (mortality > 80%) in topical and dip bioassays. However, when the insecticides were mixed with a feeding attractant, a positive effect was observed only for adults of D. suzukii . Insecticides containing neonicotinoids (acetamiprid and thiamethoxam) and pyrolle (chlorfenapyr) caused intermediate mortality to adults of D. suzukii (40?60%) and low mortality for Z. indianus (mortality < 23%); however, these compounds reduced the larval infestation of the two species by 55?86%. Botanical (azadirachtin) and sulphur insecticides exhibited low toxicity (mortality < 40%) on adults and larvae of both species. CONCLUSION: Dimethoate, malathion, spinosad, spinetoram, lambda-cyhalothrin and cyantraniliprole are highly toxic to both larvaeandadultsof D. suzukii and Z.indianus .Theuseoftoxicbaitsforadultsof D. suzukii couldbeanalternativeinmanagement of this species. © 2016 Society of Chemical Industry Keywords: spotted-wing drosophila; fig fly; chemical control; strawberry; toxic bait; pest control.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND: Drosophila suzukii is a primary insect pest that causes direct damage to fruits with a thin epidermis such as strawberries, cherries and blueberries. In strawberry fields, the co-occurrence of D. suzukii and Zaprionus indianus has increased production losses. This study evaluated the toxicities and effects of insecticidal baits to control adults and larvae of both D. suzukii and Z. indianus . RESULTS: Organophosphate (dimethoate and malathion), spinosyn (spinosad and spinetoram), pyrethroid (lambda-cyhalothrin) and diamide (cyantraniliprole) insecticides exhibited high toxicity to both adults and larvae of D. suzukii and Z. indianus (mortality > 80%) in topical and dip bioassays. However, when the insecticides were mixed with a feeding attractant, a positive effect was observed only for adults of D. suzukii . Insecticides containing neonicotinoids (acetamiprid and thiamethoxam) and pyrolle (chlorfenapyr) caused intermediate mortality to adults of D. suzukii (40?60%) and low mortality for Z. indianus (mortality < 23%); however, these compounds reduced the larval infestation of the two species by 55?86%. Botanical (azadirachtin) and sulphur insecticides exhibited low toxicity (mortality < 40%) on adults and larvae of both species. CONCLUSION: Dimethoate, malathion, spinosad, spinetoram, lambda-cyhalothrin and cyantraniliprole are highly toxic to both larvaeandadultsof D. suzukii and Z.indianus .Theuseoftoxicbaitsforadultsof D. suzukii couldbeanalternativeinmanagement of this species. © 2016 Society of Chemical Industry Keywords: spotted-wing drosophila; fig fly; chemical control; strawberry; toxic bait; pest control.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Resumo: Drosophila suzukii (Matsumura) foi recentemente detectado causando danos idade para morangos no Brasil. Infestação na cultura de morango tem frequentemente foi observado conjuntamente com a presença de Zaprionus indianus Gupta. este estudo investigou a suscetibilidade de morangos em três amadurecimento estágios para infestação de D. suzukii e Z. indianus e sua interação. Abstracts: Drosophila suzukii (Matsumura) has been recently detected causing damage to strawberries in Brazil. Infestation in strawberry culture has often been observed jointly with the presence of Zaprionus indianus Gupta. This study investigated the susceptibility of strawberries at three ripening stages to infestation of D. suzukii and Z. indianus and their interaction. In the laboratory, strawberries cv. Albion at different ripening stages (green, semi-ripe and ripe) were exposed to D. suzukii and Z. indianus for 24 h in choice and no-choice bioassays. Additionally, we evaluated the effects of mechanical damage incurred artificially or by D. suzukii ovi-position on Z. indianus infestation. In no-choice bioassay, there were no significant differences in fruit susceptibility to D. suzukii infestation at different ripening stages. However, in choice bioassay, D. suzukii adults preferred to oviposit on R fruit. The presence of mechanical damage did not increase susceptibility of fruit to D. suzukii oviposition. For Z. indianus , there was greater susceptibility of R fruit in relation to SR and G fruit in both the choice and no-choice bioassays. There was a significant and positive interaction of mechanical damage and damage caused by D. suzukii to R fruit and infestation by Z. indianus , which was not observed in SR and G fruit. Although infestation of Z. indianus is related to attack damaged or decaying fruit, this work shows that this species has the ability to oviposit and develop in healthy strawberry fruit with and increased infestation level when the fruit has damage to its epidermis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phonemic codes are accorded a privileged role in most current models of immediate serial recall, although their effects are apparent in short-term proactive interference (PI) effects as well. The present research looks at how assumptions concerning distributed representation and distributed storage involving both semantic and phonemic codes might be operationalized to produce PI in a short-term cued recall task. The four experiments reported here attempted to generate the phonemic characteristics of a nonrhyming, interfering foil from unrelated filler items in the same list. PI was observed when a rhyme of the foil was studied or when the three phonemes of the foil were distributed across three studied filler items. The results suggest that items in short-term memory are stored in terms of feature bundles and that all items are simultaneously available at retrieval.