157 resultados para Tephritidae


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential Pupal stage duration in C capitata was influenced differently for males and females In females, only soil type affected pupal stage duration, which was longer in a clay soil In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil As allude potential decreased, duration of the pupal stage of C capitata males increased, regardless of soil type C capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils The emergence of D longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil Always, the number of emerged adults was higher at higher moisture conditions C capitata and D longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Four new species of Anastrepha Schiner were collected in McPhail-type traps hung in trees in a natural reserve and in commercial papaya orchards in Linhares, Espirito Santo state, Brazil. They are described and named herein as follows: Anastrepha atlantica n. sp., Anastrepha glochin n. sp., Anastrepha linharensis n. sp. and Anastrepha martinsi n. sp. Only the latter was collected in traps hung in papaya orchards. The classification of these species in species groups of Anastrepha is also discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-july 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espirito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to determine the median lethal concentration (LC(50)) of the commercial products Boveril WP (R) (Beauveria bassiana) and Metarril WP (R) (Metarhizium anisopliae) on the larvae and pupae of the fruit Ceratitis capitata. Insects used in this study came from a laboratory colony. The evaluated product concentrations were 10.00, 15.00, 20.00 and 25.00 g/L of water, which correspond, respectively, to 5.00x10(9), 7.50x10(9), 10.00x10(9) and 12.50x10(9) viable conidia/L of water for the two products, and in the control only water was applied. Third instar larvae and pupae of C. capitata were used in this study. Results showed an overall mortality of larvae with all conidial concentrations of M. anisopliae. The LC(50) values for larvae were 2.99 and 2.97 g/L for Boveril (R) and Metarril (R), respectively, while for pupae they were 3.12 and 4.74 g/L for Boveril (R) and Metarril (R), respectively. The high pathogenicity demonstrated by lower conidial concentrations of the tested products may mean greater efficiency from both economic and environmental points of view.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A circulated heated-air treatment at 92% RH to achieve and maintain a minimum fruit core temperature of 44°C for 2 h is shown to disinfest tomatoes against Queensland fruit fly, Bactrocera tryoni (Froggatt) for market access quarantine purposes. The efficacy of the treatment exceeded 99.99%, tested at the 95% confidence level. An estimated 78 439 eggs were used for large-scale trials, as the stage of the pest most tolerant of heat at the treatment temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As moscas-das-frutas são as principais pragas da fruticultura mundial. Consideradas chaves para a produção de citros, torna-se necessário o seu monitoramento, visando a evitar os danos diretos. O experimento teve como objetivos conhecer a variação populacional de Anastrepha fraterculus e a relação de sua população com danos em pomares orgânicos de Citrus sinensis, cultivar Céu e de C. sinensis x Citrus reticulata tangor 'Murcott'. Os dados foram coletados em 2003 e 2004 durante o período de maturação dos frutos, na região do vale do Caí, RS, Brasil. O número de moscas-das-frutas foi registrado, semanalmente, por meio de armadilhas McPhail, contendo suco de uva, a 25%. Danos aos frutos foram determinados pela razão entre frutos sadios e frutos danificados pela mosca. Registros meteorológicos de temperatura, umidade relativa e precipitação pluviométrica foram obtidos, em estação meteorológica distante 30 km das áreas experimentais. Verificou-se que, em condições ideais de precipitação pluvial, maiores foram as populações de A. fraterculus, espécie predominante na região. A população estimada capaz de causar danos aos frutos variou de acordo com o cultivar, sendo a laranjeira 'Céu' a mais susceptível. Os maiores picos populacionais ocorrem na fase de mudança de coloração dos frutos. Porém, na fase de maturação, as moscas causaram os maiores danos, dada a intolerância dos frutos ao ataque. Conclui-se que a infestação dos frutos de citros por A. fraterculus está relacionada com espécie e cultivar e com fatores climáticos, principalmente com a precipitação pluvial. O monitoramento constante da população de mosca-das-frutas é importante na determinação da infestação na colheita.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foram coletados 2 630 parasìtóides de Anastrephaspp., pertencentes a cinco espécies de Braconidae, em quatro locais de dois municípios do Estado do Amazonas. Optussp. foi a espécie predominante no estudo, ocorrendo com maior freqüência na área urbana de Manaus. Doryctobracon areolatus(Szépligeti, 1911) foi a espécie predominante nas áreas rurais. As comunidades foram delimitadas e caracterizadas através de índices faunísticos. As comunidades apresentaram quocientes de similaridade entre 82 e 100%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%), Doryctobracon areolatus (Szépligeti) (26,8%) e Utetes anastrephae (Viereck) (0,7%) associados a A. obliqua (Macquart) em frutos de taperebá (Spondias mombin L.), com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L.), ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.