1000 resultados para TRICHINELLA DETECTION
Resumo:
Toxoplasma gondii causes severe disease both to man and livestock and its detection in meat after slaughtering requires PCR or biological tests. Meat packages contain retained exudate that could be used for serology due to its blood content. Similar studies reported false negative assays in those tests. We standardized an anti-T. gondii IgG ELISA in muscle juices from experimentally infected rabbits, with blood content determination by cyanhemoglobin spectrophotometry. IgG titers and immunoblotting profiles were similar in blood, serum or meat juice, after blood content correction. These assays were adequate regardless of the storage time up to 120 days or freeze-thaw cycles, without false negative results. We also found 1.35% (1/74) positive sample in commercial Brazilian rabbit meat cuts, by this assay. The blood content determination shows ELISA of meat juice may be useful for quality control for toxoplasmosis monitoring. (C) 2011 Elsevier Ltd. All rights reserved.
Resumo:
Trichinellosis is a zoonotic disease that is caused by the nematode Trichinella spp. Both European Union regulations and guidelines from the World Organization for Animal Health foresee the possibility of conducting serological surveillance for Trichinella spp. A newly developed commercial enzyme-linked immunosorbent assay (ELISA) was evaluated against 2 existing diagnostic techniques: an in-house ELISA and an in-house Western blot. A total of 875 Trichinella larva-negative samples of pigs and 93 Trichinella larva-positive samples of both naturally and experimentally infected pigs were included in the study. Bayesian modeling techniques were used to correct for the absence of a perfect reference test. The sensitivity and specificity of the commercial ELISA was 97.1-97.8% and 99.5-99.8%, respectively. Sensitivity analysis demonstrated high stability in the models. In a serological surveillance system, ELISA-positive samples should be tested by a confirmatory test. The Western blot is a suitable test for this purpose. With the use of the results of the models, the sensitivity and specificity of a test protocol in both ELISA and Western blot were 95.9% and 99.9%, respectively. The high sensitivity and specificity were achieved with a lower limit of detection than that of the routine artificial digestion test, suggesting that serological surveillance is a valuable alternative in surveillance for Trichinella spp. in pig production.
Resumo:
Trichinellosis is a zoonotic disease in humans caused by Trichinella spp. According to international regulations and guidelines, serological surveillance can be used to demonstrate the absence of Trichinella spp. in a defined domestic pig population. Most enzyme-linked immunosorbent assay (ELISA) tests presently available do not yield 100% specificity, and therefore, a complementary test is needed to confirm the diagnosis of any initial ELISA seropositivity. The goal of the present study was to evaluate the sensitivity and specificity of a Western Blot assay based on somatic Trichinella spiralis muscle stage (L1) antigen using Bayesian modeling techniques. A total of 295 meat juice and serum samples from pigs negative for Trichinella larvae by artificial digestion, including 74 potentially cross-reactive sera of pigs with other nematode infections, and 93 meat juice samples from pigs infected with Trichinella larvae were included in the study. The diagnostic sensitivity and specificity of the Western Blot were ranged from 95.8% to 96.0% and from 99.5% to 99.6%, respectively. A sensitivity analysis showed that the model outcomes were hardly influenced by changes in the prior distributions, providing a high confidence in the outcomes of the models. This validation study demonstrated that the Western Blot is a suitable method to confirm samples that reacted positively in an initial ELISA.
Resumo:
Mode of access: Internet.
Resumo:
Trichinellosis is a food-borne zoonotic disease caused by the nematode Trichinella spp. Many omnivorous and carnivorous animal species can act as host for this parasite, including domestic pigs. To protect public health, it should be ensured that pork should not contain infective Trichinella larvae. Surveillance for Trichinella spp. can be done using direct (larval detection) and indirect (antibody detection) diagnostic techniques. The aim of this study was to demonstrate the absence of infection in Swiss domestic pigs. An ELISA was used as the initial screening test, and sera reacting in ELISA were further investigated using both a Western blot for serology and an artificial digestion test with 20 g of diaphragm tissue for larval detection. A total of 7412 adult pigs, 9973 finishing pigs and 2779 free-ranging pigs were tested. Samples from 17 (0.23%) adult pigs, 16 (0.16%) finishing pigs and nine (0.32%) free-ranging pigs were ELISA-positive, but all of these sera were subsequently negative by Western blot and by the artificial digestion method. Based on these findings, an absence of Trichinella infections in adult pigs (target prevalence 0.04%) and finishing pigs (target prevalence 0.03%) can be concluded. The results also demonstrated that the prevalence of Trichinella infections does not exceed 0.11% in free-ranging pigs, the group with the highest risk of exposure.
Resumo:
Blood samples of live-caught polar bears (Ursus maritimus) from Svalbard collected 1991-2000 (Period 1) and 2006-2008 (Period 2) and from the pack ice of the Barents Sea collected in Period 1, were assayed for antibodies against Trichinella spp. by ELISA. Of 54 cubs-of-the-year included in the Period 1 sample, 53 were seronegative, indicating that exposure to Trichinella infected meat is uncommon during the first months of life for polar bears in the Svalbard region. Of 30 mother-offspring pairs, 18 mothers were seropositive with seronegative offspring (n = 27), suggesting (1) that maternal antibodies had dropped to levels below detection limit by the time of capture in April (offspring approximately 4 months old), and (2) supporting experimental studies in other animal models showing that vertical transmission of Trichinella spp. is uncommon. Bear 1 year and older had higher prevalence in Svalbard (78%) than in the Barents Sea (51%). There was no temporal change in prevalence for bears from Svalbard during the time between the two periods. The prevalence increased with age in both sexes. A positive correlation was found between anti-Toxoplasma gondii and anti-Trichinella spp. antibodies.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.