919 resultados para Stable fly
Resumo:
Outbreaks of stable fly, Stomoxys calcitrans, cause losses for livestock producers located near sugarcane mills in Brazil, especially in southern Mato Grosso do Sul. The sugarcane mills are often pointed by local farmers as the primary source of these outbreaks; some mills also joined the farmers in combating the flies. Brazilian beef cattle production has great economic importance in similar level to bio-fuel production as ethanol. In this context, the wide-ranging knowledge on the biology and ecology of the stable fly, including larval habitats and their reproduction sites is extremely important for further development of control programs. This paper aims to report the occurrence and development of S. calcitrans larvae inside sugarcane stems in three municipalities of Mato Grosso do Sul. The sugarcane stems give protection against bad weather conditions and insecticide application. In this way, for sustainable sugarcane growth specific research concerning this situation should be conducted.
Resumo:
The objective of this work was to select semivariogram models to estimate the population density of fig fly (Zaprionus indianus; Diptera: Drosophilidae) throughout the year, using ordinary kriging. Nineteen monitoring sites were demarcated in an area of 8,200 m2, cropped with six fruit tree species: persimmon, citrus, fig, guava, apple, and peach. During a 24 month period, 106 weekly evaluations were done in these sites. The average number of adult fig flies captured weekly per trap, during each month, was subjected to the circular, spherical, pentaspherical, exponential, Gaussian, rational quadratic, hole effect, K-Bessel, J-Bessel, and stable semivariogram models, using ordinary kriging interpolation. The models with the best fit were selected by cross-validation. Each data set (months) has a particular spatial dependence structure, which makes it necessary to define specific models of semivariograms in order to enhance the adjustment to the experimental semivariogram. Therefore, it was not possible to determine a standard semivariogram model; instead, six theoretical models were selected: circular, Gaussian, hole effect, K-Bessel, J-Bessel, and stable.
Resumo:
GOMES, Carlos E. M. et al. Effect of trypsin inhibitor from Crotalaria pallida seeds on Callosobruchus maculatus (cowpea weevil) and Ceratitis capitata (fruit fly). Plant Physiology and Biochemistry (Paris), v. 43, n. 12, p. 1095-1102, 2005.ISSN 0981-9428. DOI:10.1016/j.plaphy.2005.11.004.
Resumo:
The piggyBac (IFP2) short inverted terminal repeat transposable element from the cabbage looper Trichoplusia ni was tested for gene transfer vector function as part of a bipartite vector–helper system in the Mediterranean fruit fly Ceratitis capitata. A piggyBac vector marked with the medfly white gene was tested with a normally regulated piggyBac transposase helper at two different concentrations in a white eye host strain. Both experiments yielded transformants at an approximate frequency of 3–5%, with a total of six lines isolated having pigmented eyes with various levels of coloration. G1 transformant siblings from each line shared at least one common integration, with several sublines having an additional second integration. For the first transformant line isolated, two integrations were determined to be stable for 15 generations. For five of the lines, a piggyBac-mediated transposition was verified by sequencing the insertion site junctions isolated by inverse PCR that identified a characteristic piggyBac TTAA target site duplication. The efficient and stable transformation of the medfly with a lepidopteran vector represents transposon function over a relatively large evolutionary distance and suggests that the piggyBac system will be functional in a broad range of insects.
Resumo:
GOMES, Carlos E. M. et al. Effect of trypsin inhibitor from Crotalaria pallida seeds on Callosobruchus maculatus (cowpea weevil) and Ceratitis capitata (fruit fly). Plant Physiology and Biochemistry (Paris), v. 43, n. 12, p. 1095-1102, 2005.ISSN 0981-9428. DOI:10.1016/j.plaphy.2005.11.004.
Resumo:
GOMES, Carlos E. M. et al. Effect of trypsin inhibitor from Crotalaria pallida seeds on Callosobruchus maculatus (cowpea weevil) and Ceratitis capitata (fruit fly). Plant Physiology and Biochemistry (Paris), v. 43, n. 12, p. 1095-1102, 2005.ISSN 0981-9428. DOI:10.1016/j.plaphy.2005.11.004.
Resumo:
L'industrie du ciment est l'une des principales sources d'émission de dioxyde de carbone. L'industrie mondiale du ciment contribue à environ 7% des émissions de gaz à effet de serre dans l'atmosphère. Afin d'aborder les effets environnementaux associés à la fabrication de ciment exploitant en permanence les ressources naturelles, il est nécessaire de développer des liants alternatifs pour fabriquer du béton durable. Ainsi, de nombreux sous-produits industriels ont été utilisés pour remplacer partiellement le ciment dans le béton afin de générer plus d'économie et de durabilité. La performance d'un additif de ciment est dans la cinétique d'hydratation et de la synergie entre les additions et de ciment Portland. Dans ce projet, deux sous-produits industriels sont étudiés comme des matériaux cimentaires alternatifs: le résidu de silice amorphe (RSA) et les cendres des boues de désencrage. Le RSA est un sous-produit de la production de magnésium provenant de l'Alliance Magnésium des villes d'Asbestos et Thedford Mines, et les cendres des boues de désencrage est un sous-produit de la combustion des boues de désencrage, l'écorce et les résidus de bois dans le système à lit fluidisé de l'usine de Brompton située près de Sherbrooke, Québec, Canada. Récemment, les cendres des boues de désencrage ont été utilisées comme des matériaux cimentaires alternatifs. L'utilisation de ces cendres comme matériau cimentaire dans la fabrication du béton conduit à réduire la qualité des bétons. Ces problèmes sont causés par des produits d'hydratation perturbateurs des cendres volantes de la biomasse quand ces cendres sont partiellement mélangées avec du ciment dans la fabrication du béton. Le processus de pré-mouillage de la cendre de boue de désencrage avant la fabrication du béton réduit les produits d'hydratation perturbateurs et par conséquent les propriétés mécaniques du béton sont améliorées. Les approches pour étudier la cendre de boue de désencrage dans ce projet sont : 1) caractérisation de cette cendre volante régulière et pré-humidifiée, 2) l'étude de la performance du mortier et du béton incorporant cette cendre volante régulière et pré-humidifiée. Le RSA est un nouveau sous-produit industriel. La haute teneur en silice amorphe en RSA est un excellent potentiel en tant que matériau cimentaire dans le béton. Dans ce projet, l'évaluation des RSA comme matériaux cimentaires alternatifs compose trois étapes. Tout d'abord, la caractérisation par la détermination des propriétés minéralogiques, physiques et chimiques des RSA, ensuite, l'optimisation du taux de remplacement du ciment par le RSA dans le mortier, et enfin l'évaluation du RSA en remplacement partiel du ciment dans différents types de béton dans le système binaire et ternaire. Cette étude a révélé que le béton de haute performance (BHP) incorporant le RSA a montré des propriétés mécaniques et la durabilité, similaire du contrôle. Le RSA a amélioré les propriétés des mécaniques et la durabilité du béton ordinaire (BO). Le béton autoplaçant (BAP) incorporant le RSA est stable, homogène et a montré de bonnes propriétés mécaniques et la durabilité. Le RSA avait une bonne synergie en combinaison de liant ternaire avec d'autres matériaux cimentaires supplémentaires. Cette étude a montré que le RSA peut être utilisé comme nouveaux matériaux cimentaires dans le béton.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
A tracer experiment is carried out with transgenic T (variety M 7211 RR) and non-transgenic NT (variety MSOY 8200) soybean plants to evaluate if genetic modification can influence the uptake and translocation of Fe. A chelate of EDTA with enriched stable (57)Fe is applied to the plants cultivated in vermiculite plus substrate and the (57)Fe acts as a tracer. The exposure of plants to enriched (57)Fe causes the dilution of the natural previously existing Fe in the plant compartments and then the changed Fe isotopic ratio ((57)Fe/(56)Fe) is measured using a quadrupole-based inductively coupled plasma mass spectrometer equipped with a dynamic reaction cell (DRC). Mathematical calculations based on the isotope dilution methodology allow distinguishing the natural abundance Fe from the enriched Fe (incorporated during the experiment). The NT soybean plants acquire higher amounts of Fe from natural abundance (originally present in the soil) and from enriched Fe (coming from the (57)Fe-EDTA during the experiment) than T soybean ones, demonstrating that the NT soybean plants probably absorb higher amounts of Fe, independently of the source. The percentage of newly incorporated Fe (coming from the treatment) was approximately 2.0 and 1.1% for NT and T soybean plants, respectively. A higher fraction (90.1%) of enriched Fe is translocated to upper parts, and a slightly lower fraction (3.8%) is accumulated in the stems by NT plants than by T ones (85.1%; 5.1%). Moreover, in both plants, the Fe-EDTA facilitates the transport and translocation of Fe to the leaves. The genetic modification is probably responsible for differences observed between T and NT soybean plants.
Resumo:
To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.
Resumo:
We have considered a Bose gas in an anisotropic potential. Applying the the Gross-Pitaevskii Equation (GPE) for a confined dilute atomic gas, we have used the methods of optimized perturbation theory and self-similar root approximants, to obtain an analytical formula for the critical number of particles as a function of the anisotropy parameter for the potential. The spectrum of the GPE is also discussed.