1000 resultados para Notoscriptus Diptera
Resumo:
The contribution of roof gutters to Aedes aegypti (L.) and Ochlerotatus notoscriptus (Skuse) pupal populations was quantified for the first time in Cairns, Australia. Concurrent yard and roof surveys yielded ill estimated 6,934 mosquito pupae, comprising four species. Roof gutters were all uncommon but productive source of Ae. aegypti in both wet season (n = 11) and dry season (n = 2) surveys, producing 52.6% and 39.5% of the respective populations. First story gutters accounted for 92.3% of the positive gutters. Therefore, treatment of roof gutters is a critical element in Ae. aegypti control campaigns during dengue outbreaks. In wet season yards, the largest standing, crops of Ae. aegypti occurred in garden accoutrements, discarded household items, and rubbish (36.4%, 28.0%, and 20.6%, respectively). In dry season yards, rubbish produced 79.6% of the Ae. aegypti pupae. The number of Ae. aegypti pupae/person was 2.36 and 0.59 for the wet and dry season surveys, respectively.
Resumo:
This study details the novel application of predacious copepods, genus Mesocyclops, for control of Ochlerotatus tremulus (Theobald) group and Aedes aegypti (L.) mosquito larvae in subterranean habitats in north Queensland, Australia. During June 1997, 50 Mesocyclops sp. I were inoculated into one service manhole in South Townsville. Wet season rainfall and flooding in both 1998 and 2000 was responsible for the dispersal of copepods via the underground pipe system to 29 of 35 manholes over an area of 1.33 km(2). Significant reductions in Aedes and Ochlerotatus larvae ensued. In these habitats, Mesocyclops and Metacyclops were able to survive dry periods, when substrate moisture content ranged from 13.8 to 79.9%. At the semiarid inland towns of Hughenden and Richmond, cracking clay soil prevents drainage of water from shallow service pits where Oc. tremulus immatures numbered from 292-18,460 per pit. Introduction of Mesocyclops copepods into these sites during May 1999 resulted in 100% control of Oc. tremulus for 18 mo. One uninoculated pit subsequently became positive for Mesocyclops with resultant control of mosquito larvae.
Resumo:
Australian mosquitoes were evaluated for their ability to become infected with and transmit a Torres Strait strain of Japanese encephalitis virus. Mosquitoes, which were obtained from either laboratory colonies and collected using Centers for Disease Control and Prevention light traps baited with CO2 and octenol or reared from larvae, were infected by feeding on a blood/sucrose solution containing 10(4.5+/-0.1) porcine stable-equine kidney (PS-EK) tissue culture infectious dose(50)/ mosquito of the TS3306 virus strain. After 14 d, infection and transmission rates of 100% and 81%, respectively, were obtained for a southeast Queensland strain of Culex annulirostris Skuse, and 93% and 61%, respectively, for a far north Queensland strain. After 13 or more days, infection and transmission rates of > 90% and greater than or equal to 50%, respectively, were obtained for southeast Queensland strains of Culex sitiens Wiedemann and Culex quinquefasciatus Say, and a far north Queensland strain of Culex gelidus Theobald. Although infection rates were > 55%, only 17% of Ochlerotatus vigilax (Skuse) and no Cx. quinquefasciatus, collected from far north Queensland, transmitted virus. North Queensland strains of Aedes aegypti L., Ochlerotatus kochi (Donitz), and Verrallina funerea (Theobald) were relatively refractory to infection. Vertical transmission was not detected among 673 F, progeny of Oc. vigilax. Results of the current vector competence study, coupled with high field isolation rates, host feeding patterns and widespread distribution, confirm the status of Cx. annulirostris as the major vector of Japanese encephalitis virus in northern Australia. The relative roles of other species in potential Japanese encephalitis virus transmission cycles in northern Australia are discussed.
Resumo:
Laboratory bioassay studies were conducted in southeast Queensland, Australia,: on the efficacy of Teknar (R), VectoBac (R) 12AS, and Cybate (R) (active ingredient: 1,200 international toxic units Bacillus thuringiensis var, israelensis [Bti]) against 3rd instars of the arbovirus vectors Aedes aegypti. Ae. notoscriptus, Ae. vigilax, and Ae. camptorhynchus. Probit analyses were then used to determine LD,, (median lethal dose), LD95, and lethal dose ratios (LDR). Aedes aegypti and Ae. notoscriptus, both container-habitat species, tolerated the highest Bti concentrations compared with saltmarsh Ae. vigilax and Ae. camptorhynchus. For example, the LDR for Ae. vigilax versus Ae. notoscriptus exposed to Cybate was 0.14 (95% confidence limit [CL] 0.03-0.61). Similarly, the Cybate LDR for Ae. camptorhynchus versus Ae. notoscriptus was 0.22 (95% CL 0.07-0.70). Teknar produced similar results with an LDR of 0.21 (95% CL 0.04-1.10) for Aedes vigilax versus Aedes notoscriptus. Differences in product efficacy were found when tested against the 2 container-breeding species. Cybate was less effective than Teknar with LDRs of 1.55 (95% CL 0.65-3.67) and 1.87 (95% CL 0.68-5.15) for Aedes aegypti and Ae. notoscriptus, respectively. The significant differences in susceptibility between mosquito species and varying efficacy between products highlight the importance of evaluating concentration-response data prior to contracting with distributors of mosquito control products. This information is crucial to resistance management strategies.
Resumo:
At semiarid Charters Towers, north Queensland, Australia, the importance of Aedes aegypti (L.) in wells was assessed in relation to the colonization of surface habitats during the wet season. From April to July 1999, 10 wells (five positive for Ae. aegypti) were monitored to assess their status and larvae population numbers therein. All surface containers located within a 100 m radius of each well were removed, treated with s-methoprene or sealed to prevent the utilization of these containers by mosquitoes. These inner cores were surrounded by outer zones for a further 100 m in which surface containers were left untreated but all subterranean habitats were treated. Ovitraps were monitored monthly in the inner cores for 36 wk from August 1999 to April 2000 and differences in the proportions of ovitraps positive for Ae. aegypti and Ochlerotatus notoscriptus (Skuse) were analyzed by logistic regression. Analysis of the proportions of ovitraps positive for Ae. aegypti near positive wells indicated significantly greater colonization from November to March (the wet season), compared with those situated near Ae. aegypti negative wells. As Oc. notoscriptus were not produced from subterranean sites, comparisons of the proportions of ovitraps positive for Oc. notoscriptus in positive and negative inner cores provided an indication of the relative productivity of the uncontrolled surface containers in the outer zones. Differences in the utililization of ovitraps by Oc. notoscriptus among positive and negative cores were observed during only one month (March), when oviposition was greater in ovitraps in the negative cores, compared with the positive cores. Best subsets linear regression analysis of the proportion of ovitraps positive for Ae. aegypti against meteorological variables (rainfall, mean wind speed, mean relative humidity, mean minimum, and maximum temperature) during the week of ovitrapping indicated that minimum temperature and wind speed accounted for 63.4% of the variability. This study confirms that for semiarid towns such as Charters Towers, the practice of treating a relatively small number of key subterranean habitats during winter will significantly affect Ae. aegypti recolonization of surface container habitats during summer, the period of greatest risk for dengue.
Resumo:
Ochlerotatus notoscriptus (Skuse) (Diptera: Culicidae) is the predominant peridomestic mosquito in Australia where it is the primary vector of dog heartworm, Dirofilaria immitis (Leidy), and a potentially important vector of arboviruses (Barmah Forest, Ross River) with geographical variation of vector competence. Although widespread, Oc. notoscriptus has low dispersal ability, so it may have isolated subpopulations. The identification of gene flow barriers may assist in understanding arbovirus epidemiology and disease risk, and for developing control strategies for this species. We investigated the population structure of Oc. notoscriptus from 17 sites around Australia, using up to 31 putative allozyme loci, 11 of which were polymorphic. We investigated the effect of larval environment and adult morphology on genetic variation. At least five subpopulations were found, four in New South Wales (NSW) and one unique to Darwin. Perth samples appear to be a product of recent colonization from the Australian east coast. For NSW sites, a Mantel test revealed an isolation by distance effect and spatial autocorrelation analysis revealed an area of effective gene flow of 67 km, which is high given the limited dispersal ability of this species. No consistent difference was observed between 'urban' and 'sylvan' habitats, which suggests frequent movement between these sites. However, a finer-scaled habitat study at Darwin revealed small but significant allele frequency differences, including for Gpi. No fixed allozyme differences were detected for sex, size, integument colour or the colour of species-diagnostic pale scales on the scutum. The domestic habit of Oc. notoscriptus and assisted dispersal have helped to homogenize this species geographically but population structure is still detectable on several levels associated with geographical variation of vector competence.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.
Resumo:
In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.
Resumo:
On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.
Resumo:
A detecção do sexo de mosquitos da família Culicidae é importante em estudos faunísticos e epidemiológicos, pois somente as fêmeas possuem competência vetora para patógenos. O dimorfismo sexual de genitália e de apêndices cefálicos é, em geral, facilmente visível em culicídeos. As asas também podem ser dimórficas e assim poderiam complementar o procedimento de sexagem. No entanto, tal distinção não é facilmente notável à observação direta. Visando descrever formalmente o dimorfismo sexual alar em Aedes scapularis, um culicídeo vetorialmente competente para arbovírus e filárias, asas de machos e fêmeas foram comparadas usando-se métodos de morfometria geométrica e análise estatística multivariada. Nestas análises, populações dos municípios São Paulo e Pariquera-Açu (Estado de São Paulo) foram amostradas. A forma das asas mostrou evidente dimorfismo sexual, o que permitiu um índice de acurácia de 100% em testes-cegos de reclassificação, independentemente da origem geográfica. Já o tamanho alar foi sexualmente dimórfico apenas na população de São Paulo. Aparentemente, a forma alar é evolutivamente mais estável que o tamanho, interpretação que está de acordo com a teoria de Dujardin (2008b), de que a forma alar de insetos seria composta por caracteres genéticos quantitativos e pouco influenciada por fatores não-genéticos, enquanto que o tamanho alar seria predominantemente determinado por plasticidade decorrente de influências ambientais.
Resumo:
Wing diagnostic characters for Culex quinquefasciatus and Culex nigripalpus (Diptera, Culicidae). Culex quinquefasciatus and Culex nigripalpus are mosquitoes of public health interest, which can occur sympatrically in urban and semi-urban localities. Morphological identification of these species may be difficult when specimens are not perfectly preserved. In order to suggest an alternative taxonomical diagnosis, wings of these species were comparatively characterized using geometric morphometrics. Both species could be distinguished by wing shape with accuracy rates ranging from 85-100%. Present results indicate that one can identify these species relying only on wing characters when traditional taxonomical characters are not visible.