926 resultados para Myrmecophilous fly
Resumo:
This study was performed in the southern and southeastern regions of Brazil, visiting numerous municipalities, over a period of 25 years, excavating nests of 12 species of leaf-cutting ants of the Acromyrmex genus. Larvae and pupae of Microdon tigrinus were found only in nests of the leaf-cutting ant Acromyrmex coronatus, indicating high specificity. Observation showed that larvae and pupae were well accepted in the nests and the adults, immediately after puparia eclosion and prior to wing distension, were not attacked by the workers, suggesting that they produce semiochemicals for a short time period until they arrive outside the Acromyrmex coronatus nest. It was postulated that these larvae feed on the organic detritus of the nest, as shown for Microdon larvae of other species.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.
Resumo:
INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.
Resumo:
A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.
Resumo:
Objective To determine the efficacy of zeta-cypermethrin in controlling buffalo fly (Haematobia irritans exigua). Design Five field trials in northern and central Queensland. Procedure Zeta-cypermethrin pour-on at 2.5 mg/kg, spray at 62.5 ppm, deltamethrin pour-on and pour-on vehicle were applied to groups of 20 cattle. Buffalo fly counts were conducted three times before treatment and 3, 7, 14, 21, 28 and 35 days after treatment. Results In central Queensland where synthetic pyrethroid resistance in buffalo fly populations was rare, 2.5 mg/kg of zeta-cypermethrin pour-on gave good control of buffalo fly for 4 weeks and was better than a deltamethrin product. A zeta-cypermethrin spray used at 62.5 ppm gave 14 days control. In far-north Queensland where resistance to synthetic pyrethroids and heavy rain was common, the maximum period of efficacy of zeta-cypermethrin pour-on was reduced to 2 weeks. Conclusion In areas where there is low resistance to synthetic pyrethroids among buffalo flies, zeta-cypermethrin pour-on can be expected to give good control for 4 weeks.
Resumo:
The demonstration that both oxygen atoms of 1,7-dioxaspiro[5.5] undecane (1), the sex-pheromone of the female olive fly, originate from dioxygen, strongly implicates monooxygenase mediated processes in assembly of (1), and reveals unexpected complexity in the formation of its nine-carbon precursor.
Resumo:
The reproductive biology and pollination mechanisms of Govenia utriculata (Sw.) Lindl. were studied in a mesophytic semideciduous forest at Serra do Japi, south-eastern Brazil. The floral visitors and pollination mechanisms were recorded, and experimental pollinations were carried out to determine the breeding system of this species. Populations of G. utriculata growing at Serra do Japi are exclusively visited and pollinated by two species of hoverflies in the genus Salpingogaster (Diptera: Syrphidae) that are attracted by deceit to the flowers of this orchid species. The lip apex and the column base present small brownish and yellow to orange spots that mimic pollen clusters. Govenia utriculata is self-compatible, but pollinator dependent. Natural fruit set was low (10%), but similar to that of other non-obligatorily autogamous sympatric orchid species that occur at Serra do Japi and of other fly-pollinated orchid species pollinated through deceptive mechanisms.
Resumo:
A series of laboratory and glasshouse experiments were undertaken to assess the potential for incorporation of fly ash in soilless potting substrates. The physical and chemical properties of a commercially available bark based substrate, the University of California (UC) 1:1 peat:sand mix and a range uf test substrates containing fly ash were characterised. In test mixtures, fly ash was substituted for a portion of either the peat or sand component of the UC mix, at rates of 10, 20, 30 and 50% of the mix volume, Incorporation of fly ash greatly increased the plant available water capacity (10-1500 kPa) of the substrate. However, high pH, increased substrate strength and reduced air-filled porosity were considered adverse effects, particularly at ash rates > 20%. The growth of tomato (Lycopersicon esculentum), petunia (Petunia x hybrida grandiflora) and Boston fern (Nephrolepis exaltata) in the substrates was assessed. Two watering regimes, capillary watering and irregular hosing, were used to identify effects of available water capacity on plant growth, but no effect was identified. Test mixtures containing fly ash as 20% of the substrate volume produced growth equal to that in the UC mix, with substrates containing 10% ash producing significantly greater growth of tomato and petunia. At rates of incorporation > 20% reduced plant growth was attributed to both adverse physical and chemical characteristics of the substrate. As fly ash is available at low cost and can be successfully substituted for a considerable portion of the expensive peat component, its use at low application rates in potting substrates may be desirable from an economic viewpoint.
Resumo:
Pemphigus foliaceus is a life threatening skin disease that is associated with autoimmunity to desmoglein, a skin protein involved in the adhesion of keratinocytes. This disease is endemic in certain areas of South America, suggesting the mediation of environmental factors triggering autoimmunity. Among the possible environmental factors, exposure to bites of black flies, in particular Simulittm nigrimanum has been suggested. In this work, we describe the sialotranscriptome of adult female S. nigrimanum flies. It reveals the complexity of the salivary potion of this insect, comprised by over 70 distinct genes within over 30 protein families, including several novel families, even when compared with the previously described sialotranscriptome of the autogenous black fly, S. vitiation. The uncovering of this sialotranscriptome provides a platform for testing pemphigus patient sera against recombinant salivary proteins from S. nigrimanum and for the discovery of novel pharmacologically active compounds.
Resumo:
Several epidemiological studies have linked particulate matter exposure to numerous adverse health effects on the respiratory, cardiovascular, and reproductive systems (Braga et al., 1999; Zanobetti et al., 2000; Anderson et al., 2001; Farhat et al., 2005). More recently, ambient levels of black carbon were associated to impaired cognitive function in children (Suglia et al., 2008), suggesting that the central nervous system (CNS) may be a target of air pollutants. The present study was conducted to (a) determine whether chronic residual oil fly ash (ROFA) exposure promotes behavioral changes and lipid peroxidation in rat brain areas, and (b) determine whether N-acetylcysteine (NAC), a general antioxidant, prevents these effects. Forty-five-day-old male Wistar rats were exposed or not to ROFA by intranasal instillation and were treated or not with NAC (150 mg/kg) ip for 30 days. One day later, rats were submitted to the open field test to evaluate the motor/exploratory activities and emotionality followed by decapitation. Striatum and cerebellum were dissected to determine lipid peroxidation by the accumulation of thiobarbituric acid-reactive substances (TBARS). ROFA instillation induced an increase in lipid peroxidation level in striatum (p = .033) and cerebellum (p = .030), as compared with the control group. NAC treatment blocked these changes. ROFA promoted a decrease in the frequency of peripheral walking (p = .006) and a decrease in exploration (p = .001), which were not blocked by N-acetylcysteine. The present study provides evidence that toxic particles, administered by the respiratory route, induce oxidative stress in structures of the central nervous system, as well as behavioral alterations. The administration of NAC reduces lipid peroxidation at the striatum and cerebellum levels, but does not influence behavioral disturbances.
Resumo:
Epidemiological studies have demonstrated the adverse effects of particulate matter (PM) inhalation on the respiratory and cardiovascular systems. It has been reported that air pollution may affect the central nervous system and decrease cognitive function. In rats, residual oil fly ash (ROFA) instillation causes decreased motor activity and increased lipid peroxidation in the striatum and the cerebellum. Our objective was to determine whether chronic instillation of particles induces changes in learning and memory in rats and whether oxidants in the hippocampus may contribute to these adverse effects. Forty-five-day-old male Wistar rats were exposed to ROFA by intranasal instillation and were treated with N-acetylcysteine (NAC) at 150 mg/kg i.p. for 30 days. Control groups were exposed to ROFA, NAC, or neither. On days 1, 8, and 30 of the protocol, rats were submitted to the open field test to evaluate habituation. After the last open field session, the rats were killed by decapitation. The hippocampus was used to determine lipid peroxidation (LP) by the thiobarbituric acid-reactive substances test. ROFA instillation induced an increase in LP in the hippocampus compared to all treatment groups (p = .012). NAC treatment blocked these changes. All of the treatment groups presented a decrease in the frequency of peripheral walking (p = .001), rearing (p = .001), and exploration (p = .001) over time. Our study demonstrates that exposure to particles for 30 days and/or NAC treatment do not modify habituation to an open field, a simple form of learning and memory in rats, and that oxidative damage induced by ROFA does not modulate these processes.