962 resultados para Moth fly


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Thanks to recent advances in molecular systematics, our knowledge of phylogenetic relationships within the order Diptera has dramatically improved. However, relationships at lower taxonomic levels remain poorly investigated in several neglected groups, such as the highly diversified moth-fly subfamily Psychodinae (Lower Diptera), which occurs in numerous terrestrial ecosystems. In this study, we aimed to understand the phylogenetic relationships among 52 Palearctic taxa from all currently known Palearctic tribes and subtribes of this subfamily, based on mitochondrial DNA. Our results demonstrate that in light of the classical systematics of Psychodinae, none of the tribes sensu Je?ek or sensu Vaillant is monophyletic, whereas at least five of the 12 sampled genera were not monophyletic. The results presented in this study provide a valuable backbone for future work aiming at identifying morphological synapomorphies to propose a new tribal classification.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

A new species of Sycorax Curtis, 1839 (Diptera, Psychodidae) from the Atlantic Forest in southeastern Brazil. Sycorax bravoi Santos, Ferreira & Falqueto sp. nov. is described and illustrated based on samples collected with a Möricke trap installed on the ground at the Biological Station of Santa Lúcia, municipality of Santa Teresa, in the Brazilian state of Espírito Santo. Males have a paramere with a spiniform prolongation on the distal surface and an aedeagus with a long posterior membranous dorsal prolongation. Females have a racket-shaped genital furca and tubular spermatheca, tapered on the apical third. This finding raises the number of Sycorax species known from Brazil to seven.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The behavioral inhibitory effect of methanol extracts from neem leaves (Azadirachta indica A. Juss) at different concentrations (0, 10,000, 18,000, 32,000 and 56,000 ppm) was evaluated using naive and experienced medflies (Ceratitis capitata (Wied.)) ovipositing on the fruits of grape cv. 'Italia'. The grapes were immersed in the specific treatments and were exposed for 24 h to 3 pairs of female and male medflies, both nave and experienced, in a choice test. At concentrations >= 18,000 ppm, the extract that was applied to the grapes inhibited oviposition. The previous experience with treated grapes did not affect the response of the medflies. This study is the first step toward the application of the behavior control of the medflies as a tool in grape vineyards. The potential for using oviposition inhibitory in behavioral control of C. capitata are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The identity of Laemocharis ignicolor Ménétriés, 1857 is established for the first time and is synonymized under Cosmosoma erythrarchos (Walker, 1854), syn. n.; lectotypes for L. ignicolor and L. vulnerata Herrich-Schäffer, [1854] are here designated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As insects increase in radiotolerance as they develop and usually several developmental stages of the pest may be present in the fresh shipped commodity, it is important to know the radiation susceptibility of the stages of the target insect before the establishment of ionizing radiation quarantine treatments. This study was performed to determine the radiotolerance of eggs of the oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), to gamma radiation. This species is considered as one of the most serious worldwide pests for temperate fruits, especially peaches. Eggs (12 h old) were exposed to 0 (control), 25, 35, 50, 75, 100, 125 and 150 Gy of gamma radiation. Surviving larvae were allowed to feed on an artificial diet. Three days after irradiation, it was verified that larvae`s cephalic capsules were significantly affected by gamma radiation, and the estimated mean LD(90) and LD(99) were 66.3 Gy and 125.8 Gy, respectively. Oriental fruit moth eggs revealed to be quite radiosensitive and very low doses as 50 Gy were sufficient to disrupt G. molesta embryogenesis. At 25 Gy, only male adults originated from the surviving larvae and, after mating with untreated fertile females, shown to be sterile. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plant volatiles function as important signals for herbivores, parasitoids, predators, and neighboring plants. Herbivore attack can dramatically increase plant volatile emissions in many species. However, plants do not only react to herbivore-inflicted damage, but also already start adjusting their metabolism upon egg deposition by insects. Several studies have found evidence that egg deposition itself can induce the release of volatiles, but little is known about the effects of oviposition on the volatiles released in response to subsequent herbivory. To study this we measured the effect of oviposition by Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) moths on constitutive and herbivore-induced volatiles in maize (Zea mays L.). Results demonstrate that egg deposition reduces the constitutive emission of volatiles and suppresses the typical burst of inducible volatiles following mechanical damage and application of caterpillar regurgitant, a treatment that mimics herbivory. We discuss the possible mechanisms responsible for reducing the plant`s signaling capacity triggered by S. frugiperda oviposition and how suppression of volatile organic compounds can influence the interaction between the plant, the herbivore, and other organisms in its environment. Future studies should consider oviposition as a potential modulator of plant responses to insect herbivores.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective To determine the efficacy of zeta-cypermethrin in controlling buffalo fly (Haematobia irritans exigua). Design Five field trials in northern and central Queensland. Procedure Zeta-cypermethrin pour-on at 2.5 mg/kg, spray at 62.5 ppm, deltamethrin pour-on and pour-on vehicle were applied to groups of 20 cattle. Buffalo fly counts were conducted three times before treatment and 3, 7, 14, 21, 28 and 35 days after treatment. Results In central Queensland where synthetic pyrethroid resistance in buffalo fly populations was rare, 2.5 mg/kg of zeta-cypermethrin pour-on gave good control of buffalo fly for 4 weeks and was better than a deltamethrin product. A zeta-cypermethrin spray used at 62.5 ppm gave 14 days control. In far-north Queensland where resistance to synthetic pyrethroids and heavy rain was common, the maximum period of efficacy of zeta-cypermethrin pour-on was reduced to 2 weeks. Conclusion In areas where there is low resistance to synthetic pyrethroids among buffalo flies, zeta-cypermethrin pour-on can be expected to give good control for 4 weeks.