Efficacy of zeta-cypermethrin as pour-on or spray formulations for the control of buffalo fly (Haematobia irritans exigua) in cattle

Objective To determine the efficacy of zeta-cypermethrin in controlling buffalo fly (Haematobia irritans exigua). Design Five field trials in northern and central Queensland. Procedure Zeta-cypermethrin pour-on at 2.5 mg/kg, spray at 62.5 ppm, deltamethrin pour-on and pour-on vehicle were applied to groups of 20 cattle. Buffalo fly counts were conducted three times before treatment and 3, 7, 14, 21, 28 and 35 days after treatment. Results In central Queensland where synthetic pyrethroid resistance in buffalo fly populations was rare, 2.5 mg/kg of zeta-cypermethrin pour-on gave good control of buffalo fly for 4 weeks and was better than a deltamethrin product. A zeta-cypermethrin spray used at 62.5 ppm gave 14 days control. In far-north Queensland where resistance to synthetic pyrethroids and heavy rain was common, the maximum period of efficacy of zeta-cypermethrin pour-on was reduced to 2 weeks. Conclusion In areas where there is low resistance to synthetic pyrethroids among buffalo flies, zeta-cypermethrin pour-on can be expected to give good control for 4 weeks.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Phenotypic Polymorphism Of Chrysomya Albiceps (wiedemann) (diptera: Calliphoridae) May Lead To Species Misidentification.

Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.

Competição larval em Chrysomya megacephala (F.) (Diptera: Calliphoridae): efeitos de diferentes níveis de agregação larval sobre estimativas de peso, fecundidade e investimento reprodutivo

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Dimorfismo sexual alar em Aedes scapularis (Diptera: Culicidae)

A detecção do sexo de mosquitos da família Culicidae é importante em estudos faunísticos e epidemiológicos, pois somente as fêmeas possuem competência vetora para patógenos. O dimorfismo sexual de genitália e de apêndices cefálicos é, em geral, facilmente visível em culicídeos. As asas também podem ser dimórficas e assim poderiam complementar o procedimento de sexagem. No entanto, tal distinção não é facilmente notável à observação direta. Visando descrever formalmente o dimorfismo sexual alar em Aedes scapularis, um culicídeo vetorialmente competente para arbovírus e filárias, asas de machos e fêmeas foram comparadas usando-se métodos de morfometria geométrica e análise estatística multivariada. Nestas análises, populações dos municípios São Paulo e Pariquera-Açu (Estado de São Paulo) foram amostradas. A forma das asas mostrou evidente dimorfismo sexual, o que permitiu um índice de acurácia de 100% em testes-cegos de reclassificação, independentemente da origem geográfica. Já o tamanho alar foi sexualmente dimórfico apenas na população de São Paulo. Aparentemente, a forma alar é evolutivamente mais estável que o tamanho, interpretação que está de acordo com a teoria de Dujardin (2008b), de que a forma alar de insetos seria composta por caracteres genéticos quantitativos e pouco influenciada por fatores não-genéticos, enquanto que o tamanho alar seria predominantemente determinado por plasticidade decorrente de influências ambientais.

Wing diagnostic characters for Culex quinquefasciatus and Culex nigripalpus (Diptera, Culicidae)

Wing diagnostic characters for Culex quinquefasciatus and Culex nigripalpus (Diptera, Culicidae). Culex quinquefasciatus and Culex nigripalpus are mosquitoes of public health interest, which can occur sympatrically in urban and semi-urban localities. Morphological identification of these species may be difficult when specimens are not perfectly preserved. In order to suggest an alternative taxonomical diagnosis, wings of these species were comparatively characterized using geometric morphometrics. Both species could be distinguished by wing shape with accuracy rates ranging from 85-100%. Present results indicate that one can identify these species relying only on wing characters when traditional taxonomical characters are not visible.

A catalogue of types of Conopoidea, Diopsoidea, Nerioidea and Tephritoidea (Diptera, Schizophora) in the collection of the Museu de Zoologia da Universidade de São Paulo

A catalogue is provided with the type material of four superfamilies of "Acalyptrate" (Conopoidea, Diopsoidea, Nerioidea and Tephritoidea) held in the collection of the Museu de Zoologia da Universidade de São Paulo (MZUSP), São Paulo, Brazil. Concerning the taxa dealt with herein, the Diptera collection of MZUSP held 77 holotypes, 4 "allotypes" and 194 paratypes. In this paper, information about data labels, preservation and missing structures of the type specimens is given.

Description of the larva and pupal case of Ommatius orenoquensis Bigot (Diptera, Asilidae, Ommatiinae)

Description of the larva and pupal case of Ommatius orenoquensis Bigot (Diptera, Asilidae, Ommatiinae). The last instar larva and the pupal case of Ommatius orenoquensis Bigot, 1896 from a Cerrado (Brazilian Savanna) area in São Paulo, southeastern Brazil, are for the first time described and illustrated.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Redescription of two neotropical species of Toxophora Meigen (Diptera, Bombyliidae, Toxophorinae)

Two neotropical species of Toxophora Meigen, 1848 are redescribed (T. aurea Macquart, 1848 and T. leucon Séguy, 1930) and the male terminalia, female spermathecae, and the eggs are described and illustrated. Both species can be easily segregated from the other congeners by the following features: T. leucon: body covered with dark brown scales, longitudinal stripe formed by yellow scales on center of mesonotum, scutellum and abdomen, and abdomen slender; T. aurea: antenna with short dark brown scales, body covered with yellow scales and spots of dark brown scales with greenish reflex, wings without inter-radial vein, femora with yellow scales and without setae on males, and abdomen stout.

Revision of the genus Physoclypeus Hendel, 1907 (Diptera, Lauxaniidae), with description of seven new species

The genus Physoclypeus Hendel, 1907 has its distribution restricted to the Neotropical region. In this study, its species have been redescribed, three new combinations have been proposed, three lectotypes have been designated, seven new species have been described, and an identification key to the species is presented. An updated list of species of Physoclypeus is presented as: P. annulatus Hendel, 1925; P. coquilletti (Hendel, 1908); P. farinosus (Hendel, 1925); P. flavus (Wiedemann, 1830); P. hendeli sp. nov. (Type locality, Jamaica, N. Irish Town); P. lineatus (Williston, 1896) new comb.; P. montanus (Becker, 1919) new comb.; P. plaumanni sp. nov. (Type locality, Brazil, Santa Catarina); P. risaraldensis sp. nov. (Type locality, Colombia, Risaralda); P. saltensis sp. nov. (Type locality, Argentina, Salta); P. scutellatus (Curran, 1926) new comb.; P. unimaculatus sp. nov. (Type locality, Mexico, Vera Cruz); P. vitattus sp. nov. (Type locality, Brazil, Santa Catarina) and P. zebrinus sp. nov. (Type locality, Costa Rica, Limón).