922 resultados para Lychee Fruit


Relevância:

70.00% 70.00%

Publicador:

Resumo:

Lychee (Litchi chinensis Sonn.) has a high commercial value; however, it has a short shelf-life because of its rapid pericarp browning. The objective of this study was to evaluate the shelf-life of 'Bengal' lychee fruits stored after treatment with hydrochloric acid and citric acid, associated with cassava starch and plastic packaging. Uniformly red pericarp fruits were submitted to treatments: 1-(immersion in citric acid 100 mM for 5 minutes + cassava starch 30 g L-1 for 5 minutes), 2-(immersion in hydrochloric acid 1 M for 2 minutes + starch cassava 30 g L-1 for 5 minutes), 3-(immersion in citric acid 100 mM for 5 minutes + polyvinyl chloride film (PVC, 14 µm thick)) and 4-(immersion in hydrochloric acid 1 M for 2 minutes + PVC film). During 20 days, the fruits were evaluated for mass loss, pericarp color, pH, soluble solids and titratable acidity, vitamin C of the pulp and pericarp and activities of polyphenol oxidase and peroxidase of the pericarp. The treatment with hydrochloric acid associated with PVC was the most effective in maintaining the red color of the pericarp for a period of 20 days and best preservation of the fruit. The cassava starch associated with citric acid, and hydrochloric acid did not reduce the mass loss and did not prevent the browning of lychee fruit pericarp.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Litchi (Litchi chinensis Sonn.) is a subtropical to tropical fruit of high commercial value in international trade. However, harvested litchi fruit rapidly lose their bright red skin colour. Peel browning of harvested litchi fruit has largely been attributed to rapid degradation of red anthocyanin pigments. This process is associated with enzymatic oxidation of phenolics by polyphenol oxidase (PPO) and/or peroxidase (POD). PRO and POD from litchi pericarp cannot directly oxidize anthocyanins. Moreover, PPO substrates in the pericarp are not well characterised. Consequently, the roles of PPO and POD in litchi browning require further investigation. Recently, an anthocyanase catalysing the hydrolysis of sugar moieties from anthocyanin to anthocyanidin has been identified in litchi peel for the first time. Thus, litchi enzymatic browning may involve an anthocyanase-anthocyanin-phenolic-PPO reaction. Current research focus is on characterising the properties of the anthocyanase involved in anthocyanin degradation. Associated emphasis is on maintenance of membrane functions in relation to loss of compartmentation between litchi peel oxidase enzymes and their substrates. (C) 2004 Elsevier Ltd. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Litchi ( Litchi chinensis Sonn.) is a tropical to subtropical crop that originated in South-East Asia. Litchi fruit are prized on the world market for their flavour, semi-translucent white aril and attractive red skin. Litchi is now grown commercially in many countries and production in Australia, China, Israel, South Africa and Thailand has expanded markedly in recent years. Increased production has made significant contributions to economic development in these countries, especially those in South-East Asia. Non-climacteric litchi fruit are harvested at their visual and organoleptic optimum. They are highly perishable and, consequently, have a short life that limits marketability and potential expansion of demand. Pericarp browning and pathological decay are common and important defects of harvested litchi fruit. Postharvest technologies have been developed to reduce these defects. These technologies involve cooling and heating the fruit, use of various packages and packaging materials and the application of fungicides and other chemicals. Through the use of fungicides and refrigeration, litchi fruit have a storage life of about 30 days. However, when they are removed from storage, their shelf life at ambient temperature is very short due to pericarp browning and fruit rotting. Low temperature acclimation or use of chitsoan as a coating can extend the shelf life. Sulfur dioxide fumigation effectively reduces pericarp browning, but approval from Europe, Australia and Japan for this chemical is likely to be withdrawn due to concerns over sulfur residues in fumigated fruit. Thus, sulfur-free postharvest treatments that maintain fruit skin colour are increasingly important. Alternatives to SO2 fumigation for control of pericarp browning and fruit rotting are pre-storage pathogen management, anoxia treatment, and dipping in 2% hydrogen chloride solution for 6-8 min following storage at 0 degrees C. Insect disinfestation has become increasingly important for the expansion of export markets because of quarantine issues associated with some fruit fly species. Thus, effective disinfestation protocols need to be developed. Heat treatment has shown promise as a quarantine technology, but it injures pericarp tissue and results in skin browning. However, heat treatment can be combined with an acid dip treatment that inhibits browning. Therefore, the primary aim of postharvest litchi research remains the achievement of highly coloured fruit which is free of pests and disease. Future research should focus on disease control before harvest, combined acid and heat treatments after harvest and careful temperature management during storage and transport.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: The purpose of this paper is to characterize lychee seeds regarding their centesimal composition, and also to evaluate their antioxidant potential and fatty acid profile. Design/methodology/approach: To obtain the extract, dehydrated and grinded seeds were extracted with ethyl alcohol for 30 min, at a proportion of 1:3 of seeds:ethyl alcohol, under continuous agitation, at room temperature. Afterwards, the mixture was filtered and the supernatant subjected to a rotoevaporator at 40oC aiming to determine, by direct weighing, the extract dry matter yield. Findings: The largest found values went to the total carbohydrates (72.75 percent). In the oil from the lychee seeds there was a high percentage of unsaturated fatty acids, the main component being linoleic, considered an essential fatty acid. Research limitations/implications: Implies the identification of compounds biativos extracted from seeds of tropical and subtropical fruits, and to prevent certain types of diseases. Originality/value: The article tries to identify new source of phenolic compounds extracted from fruit. © Emerald Group Publishing Limited.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The lychee (Litchi chinensis Sonnerat), of the family Sapindaceae, is a highly valued fruit throughout the world. It is native to southern China, but it is cultivated in many parts of the world. In Brazil, the cultivation of the lychee was initiated in the 1970s in the State of São Paulo and has been increasing in production even though the crop size still averages only 1.4 ha per producer. The low crop size is attributed to the high cost of seedlings and the amount of time required for the plant to bear fruit. These factors discourage planting in large areas. The purpose of this research is to study some aspects of what is vitally important for the production of lychee seedlings on a large scale, with low cost and good genetic quality. Tests were performed using rootstocks from seeds of lychee and longan (Euphoria longan Lam.). Scions for grafting were taken from plants of lychee 'Bengal' in the collection of fruit species from FCAV-UNESP, Campus of Jaboticabal, Brazil. The experiments were started in September 2007 and the grafting process was performed in each month of the year finishing in August 2008. During this period the influence of these criteria were evaluated: 1) time of the year; 2) species of rootstock; 3) percentage of grafting success; 4) stem height at grafting point; 5) stem diameter at grafting point. Therefore, through statistical analysis we obtained significant differences in relation to the rootstock used, the months of the year in which the grafting was performed and the interaction between rootstock and the month in which the grafting was performed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.